:root {
  font-family: Inter, "SF Pro Display", "Segoe UI", Arial, sans-serif;
  color: var(--ink);
  background: var(--page-bg);
  font-synthesis: none;
  text-rendering: optimizeLegibility;
  -webkit-font-smoothing: antialiased;
  --blue: #1777d2;
  --cyan: #26d8ff;
  --violet: #8a62ff;
  --magenta: #ec3b9d;
  --red: #c92f3b;
  --showcase-width: 1280px;
}

* {
  box-sizing: border-box;
}

html {
  scroll-behavior: smooth;
}

body {
  margin: 0;
  min-height: 100vh;
  color: var(--ink);
}

a {
  color: inherit;
  text-decoration: none;
}

.theme-white {
  --ink: #0b1426;
  --muted: rgba(11, 20, 38, 0.64);
  --soft: rgba(11, 20, 38, 0.52);
  --page-bg: #eef3f8;
  --surface: rgba(255, 255, 255, 0.68);
  --surface-strong: rgba(255, 255, 255, 0.88);
  --line: rgba(39, 82, 120, 0.13);
  --shadow: rgba(25, 55, 92, 0.16);
  --grid: rgba(30, 100, 167, 0.09);
  --card-text: #10213c;
  --card-muted: rgba(11, 20, 38, 0.62);
  --glass-edge: rgba(38, 216, 255, 0.52);
  --layer-shadow: rgba(23, 119, 210, 0.16);
  background:
    radial-gradient(circle at 82% 9%, rgba(0, 170, 255, 0.24), transparent 30%),
    radial-gradient(circle at 16% 44%, rgba(108, 76, 255, 0.16), transparent 28%),
    radial-gradient(circle at 74% 76%, rgba(236, 59, 157, 0.13), transparent 30%),
    radial-gradient(circle at 36% 92%, rgba(0, 208, 157, 0.12), transparent 26%),
    linear-gradient(180deg, #f6f9ff, #e8f0f8 44%, #f8fbff);
}

.theme-dark {
  --ink: #f2f8ff;
  --muted: rgba(213, 231, 247, 0.7);
  --soft: rgba(188, 214, 236, 0.58);
  --page-bg: #030711;
  --surface: rgba(8, 18, 35, 0.7);
  --surface-strong: rgba(12, 27, 53, 0.9);
  --line: rgba(137, 193, 236, 0.22);
  --shadow: rgba(0, 112, 255, 0.25);
  --grid: rgba(125, 183, 232, 0.11);
  --card-text: #eff8ff;
  --card-muted: rgba(215, 233, 248, 0.72);
  --glass-edge: rgba(58, 205, 255, 0.6);
  --layer-shadow: rgba(0, 116, 255, 0.28);
  background:
    radial-gradient(circle at 82% 12%, rgba(0, 184, 255, 0.26), transparent 32%),
    radial-gradient(circle at 13% 46%, rgba(91, 84, 255, 0.22), transparent 31%),
    radial-gradient(circle at 72% 74%, rgba(214, 74, 255, 0.16), transparent 30%),
    radial-gradient(circle at 31% 88%, rgba(0, 223, 194, 0.13), transparent 28%),
    #030711;
}

.theme-dark .card,
.theme-dark .panel,
.theme-dark .package,
.theme-dark .video-strip,
.theme-dark .hero-surface,
.theme-dark .float-layer {
  color: #eef7ff;
}

.theme-dark .button.secondary {
  color: #eef7ff;
}

.theme-dark .mode-switch a,
.theme-dark .mini-card,
.theme-dark .dash-card,
.theme-dark .data-pill,
.theme-dark .stat {
  color: var(--card-muted);
  background: rgba(12, 27, 53, 0.62);
}

.theme-dark .surface-header,
.theme-dark .brand small,
.theme-dark .stat span {
  color: rgba(205, 226, 244, 0.62);
}

.theme-dark h1,
.theme-dark h2,
.theme-dark h3,
.theme-dark h4,
.theme-dark .section-head h2,
.theme-dark .workflow h3,
.theme-dark .package h3 {
  color: #f2f8ff;
}

.site {
  position: relative;
  min-height: 100vh;
  overflow: hidden;
}

.site::before {
  content: "";
  position: fixed;
  inset: 0;
  pointer-events: none;
  background:
    linear-gradient(var(--grid) 1px, transparent 1px),
    linear-gradient(90deg, var(--grid) 1px, transparent 1px);
  background-size: 42px 42px;
  mask-image: radial-gradient(circle at 62% 20%, black, transparent 68%);
  opacity: 0.52;
}

.orb {
  position: absolute;
  pointer-events: none;
  border-radius: 999px;
  filter: blur(14px);
  opacity: 0.82;
}

.orb-a {
  right: -150px;
  top: 190px;
  width: 620px;
  height: 620px;
  background: radial-gradient(circle, rgba(38, 216, 255, 0.28), transparent 68%);
}

.orb-b {
  left: 6%;
  top: 46%;
  width: 360px;
  height: 360px;
  background: radial-gradient(circle, rgba(138, 98, 255, 0.24), transparent 70%);
}

.orb-c {
  right: 18%;
  bottom: 12%;
  width: 300px;
  height: 300px;
  background: radial-gradient(circle, rgba(236, 59, 157, 0.18), transparent 72%);
}

.nav {
  position: relative;
  z-index: 4;
  display: flex;
  justify-content: space-between;
  align-items: center;
  gap: 24px;
  padding: 30px clamp(28px, 5vw, 72px);
  font-size: 13px;
}

.nav-left,
.brand {
  display: flex;
  align-items: center;
  gap: 16px;
  font-weight: 760;
}

.biointron-mark {
  position: relative;
  display: inline-flex;
  align-items: center;
  width: clamp(118px, 10vw, 158px);
  min-width: 112px;
}

.biointron-mark::before {
  content: "";
  position: absolute;
  left: 50%;
  bottom: -11px;
  width: 8px;
  height: 8px;
  border-left: 1px solid var(--line);
  border-top: 1px solid var(--line);
  background: var(--surface-strong);
  opacity: 0;
  transform: translate(-50%, 4px) rotate(45deg);
  transition: opacity 180ms ease, transform 180ms ease;
  pointer-events: none;
}

.biointron-mark::after {
  content: "HOME";
  position: absolute;
  left: 50%;
  bottom: -40px;
  padding: 6px 11px;
  border: 1px solid var(--line);
  border-radius: 999px;
  color: var(--text);
  background: color-mix(in srgb, var(--surface-strong) 92%, transparent);
  box-shadow: 0 12px 26px rgba(17, 45, 78, 0.12);
  font-size: 11px;
  font-weight: 820;
  letter-spacing: 0.08em;
  opacity: 0;
  transform: translate(-50%, 4px);
  transition: opacity 180ms ease, transform 180ms ease;
  pointer-events: none;
  backdrop-filter: blur(14px);
}

.biointron-mark:hover::before,
.biointron-mark:focus-visible::before,
.biointron-mark:hover::after,
.biointron-mark:focus-visible::after {
  opacity: 1;
  transform: translate(-50%, 0) rotate(45deg);
}

.biointron-mark:hover::after,
.biointron-mark:focus-visible::after {
  transform: translate(-50%, 0);
}

.biointron-mark img,
.bio-footer-logo img {
  display: block;
  width: 100%;
  height: auto;
}

.theme-dark .biointron-mark img,
.theme-dark .bio-footer-logo img {
  filter: brightness(0) invert(1);
}

.bio-footer a:hover {
  color: var(--cyan);
}

.brand small {
  color: var(--soft);
  font-size: 12px;
}

.brand strong {
  font-size: 20px;
  color: var(--ink);
}

.red {
  color: var(--red);
}

.theme-dark .brand strong {
  color: #f1f8ff;
}

.theme-dark .red {
  color: #ff6474;
}

.mode-switch {
  display: flex;
  align-items: center;
  justify-content: center;
  flex: 1 1 auto;
  gap: 8px;
  min-width: 0;
}

.nav-actions {
  display: flex;
  align-items: center;
  justify-content: flex-end;
  gap: 8px;
  flex: 0 0 auto;
}

.nav-product {
  color: var(--ink);
  font-size: 18px;
  font-weight: 860;
  line-height: 1;
}

.nav-product span {
  color: var(--red);
}

.theme-dark .nav-product {
  color: #f4fbff;
}

.theme-dark .nav-product span {
  color: #ff6978;
}

.mode-switch a {
  display: inline-flex;
  align-items: center;
  min-height: 34px;
  padding: 0 13px;
  border: 1px solid var(--line);
  border-radius: 999px;
  background: rgba(255, 255, 255, 0.05);
  color: var(--soft);
  font-size: 12px;
  font-weight: 760;
  white-space: nowrap;
}

.mode-switch a:hover {
  color: var(--ink);
  background: var(--surface-strong);
}

.theme-toggle {
  position: static;
  flex: 0 0 auto;
  display: grid;
  place-items: center;
  width: 38px;
  height: 38px;
  padding: 0;
  border: 1px solid var(--line);
  border-radius: 999px;
  color: var(--text);
  background: var(--surface-strong);
  box-shadow: 0 12px 28px rgba(17, 45, 78, 0.1);
  cursor: pointer;
}

.theme-toggle:hover {
  transform: translateY(-1px);
}

.theme-icon {
  display: none;
  width: 18px;
  height: 18px;
}

.theme-icon svg {
  display: block;
  width: 100%;
  height: 100%;
  fill: none;
  stroke: currentColor;
  stroke-width: 2;
  stroke-linecap: round;
  stroke-linejoin: round;
}

.theme-toggle[data-theme-mode="light"] .theme-icon-sun,
.theme-toggle[data-theme-mode="dark"] .theme-icon-moon,
.theme-toggle[data-theme-mode="system"] .theme-icon-system {
  display: block;
}

.language-switch {
  display: inline-flex;
  align-items: center;
  height: 38px;
  padding: 3px;
  border: 1px solid var(--line);
  border-radius: 999px;
  background: rgba(255, 255, 255, 0.05);
}

.language-switch button {
  min-width: 38px;
  height: 25px;
  padding: 0 9px;
  border: 0;
  border-radius: 999px;
  color: var(--soft);
  background: transparent;
  font: inherit;
  font-size: 12px;
  font-weight: 760;
  cursor: pointer;
}

.language-switch button[aria-pressed="true"] {
  color: var(--page-bg);
  background: var(--ink);
}

.theme-dark .language-switch button[aria-pressed="true"] {
  color: #06101f;
  background: #eef7ff;
}

.section {
  position: relative;
  z-index: 2;
  padding: clamp(72px, 8vw, 118px) clamp(28px, 6vw, 88px);
}

.hero {
  display: grid;
  grid-template-columns: minmax(0, 1.06fr) minmax(360px, 0.94fr);
  gap: clamp(72px, 8vw, 128px);
  align-items: center;
  min-height: 810px;
  padding-top: 68px;
  overflow: visible;
}

.hero > div:first-child {
  position: relative;
  z-index: 6;
}

.eyebrow {
  margin: 0 0 22px;
  color: color-mix(in srgb, var(--blue), var(--ink) 18%);
  font-size: 12px;
  font-weight: 760;
  letter-spacing: 0;
  text-transform: uppercase;
}

.theme-dark .eyebrow {
  color: #9ed6ff;
}

html[lang="zh-CN"] .hero-eyebrow {
  display: none;
}

h1,
h2,
h3,
p {
  margin: 0;
}

h1 {
  max-width: 860px;
  font-size: clamp(58px, 7.4vw, 118px);
  font-weight: 680;
  line-height: 0.94;
  letter-spacing: 0;
}

.brand-hero {
  display: inline-block;
  width: max-content;
  max-width: none;
  margin-bottom: 18px;
  padding-right: 0.08em;
  font-size: clamp(76px, 10vw, 156px);
  font-weight: 760;
  line-height: 0.86;
  letter-spacing: 0;
  overflow: visible;
}

.neon-text {
  background: linear-gradient(100deg, #0b1c32 0%, #11355d 42%, #1c6fa8 72%, #587ebf 91%, #8a6aa8 100%);
  -webkit-background-clip: text;
  background-clip: text;
  color: transparent;
  text-shadow: 0 0 18px rgba(38, 216, 255, 0.1);
}

.theme-dark .neon-text {
  background: linear-gradient(100deg, #f7fbff 0%, #d7efff 40%, #95d6f5 70%, #9ab7ee 90%, #b79cde 100%);
  -webkit-background-clip: text;
  background-clip: text;
  color: transparent;
  text-shadow:
    0 0 14px rgba(38, 216, 255, 0.15),
    0 0 34px rgba(92, 151, 255, 0.12);
}

.hero-title {
  display: inline-block;
  width: min(100%, 800px);
  max-width: 800px;
  padding-right: 0.04em;
  font-size: clamp(26px, 2.7vw, 46px);
  line-height: 1.08;
  white-space: normal;
  overflow: visible;
  color: #123b68;
  text-shadow: none;
}

.theme-dark .hero-title {
  color: #bfe7f7;
}

.theme-white .hero-title {
  color: #123b68;
}

.hero-rollup-subtitle {
  max-width: 900px;
  margin-top: 22px;
  color: #274f98;
  font-size: clamp(24px, 2.9vw, 48px);
  font-style: italic;
  font-weight: 860;
  line-height: 1.08;
  letter-spacing: 0;
}

.hero-rollup-subtitle span {
  color: #c92f3b;
}

.typing-line {
  position: relative;
  display: inline-block;
  max-width: min(100%, 800px);
  padding: 0.08em 0.08em 0.36em 0;
  line-height: 1.24;
  white-space: normal;
  overflow: visible;
  opacity: 1;
  transform: translate3d(0, 0, 0);
  transition:
    opacity 240ms ease-out,
    transform 360ms cubic-bezier(0.2, 1, 0.34, 1);
}

.hero-title.typing-line {
  display: block;
  width: 100%;
  max-width: 800px;
  box-sizing: border-box;
  height: calc(4 * 1.24em + 0.58em);
  min-height: 0;
  overflow: visible;
  contain: layout;
}

html[lang="zh-CN"] .hero-title.typing-line {
  height: calc(3 * 1.24em + 0.58em);
}

.typing-line .type-char {
  display: inline-block;
  opacity: 0;
  padding: 0 0.006em 0.18em 0;
  line-height: 1.24;
  background: none;
  -webkit-background-clip: initial;
  background-clip: initial;
  color: inherit;
  transform: translate3d(0, 0.1em, 0) scale(0.94);
  transition:
    opacity 180ms ease-out,
    transform 420ms cubic-bezier(0.2, 1.55, 0.34, 1);
  will-change: opacity, transform;
}

.theme-white .typing-line .type-char {
  color: inherit;
  background: none;
  -webkit-background-clip: initial;
  background-clip: initial;
}

.typing-line .type-word {
  display: inline-block;
  white-space: nowrap;
}

.theme-dark .typing-line .type-char {
  color: inherit;
  background: none;
  -webkit-background-clip: initial;
  background-clip: initial;
}

.typing-line .type-char.is-visible {
  opacity: 1;
  transform: translate3d(0, 0, 0) scale(1);
}

.typing-line.is-resetting .type-char {
  opacity: 0;
  transform: translate3d(0, 0.1em, 0) scale(0.94);
  transition: none;
}

.typing-line.is-resetting {
  opacity: 0;
  transform: translate3d(0, 0.08em, 0);
  transition: none;
}

.typing-line .type-space {
  display: inline-block;
  width: 0.32em;
}

.typing-line .type-cursor {
  display: inline-block;
  width: 0.08em;
  height: 0.82em;
  margin-left: 0.1em;
  border-radius: 999px;
  background: linear-gradient(180deg, var(--cyan), var(--violet));
  box-shadow:
    0 0 14px rgba(38, 216, 255, 0.5),
    0 0 30px rgba(138, 98, 255, 0.28);
  transform: translateY(0.12em);
  animation: cursorBlink 900ms steps(2, end) infinite;
}

@keyframes cursorBlink {
  0%,
  48% {
    opacity: 1;
  }

  49%,
  100% {
    opacity: 0.18;
  }
}

@media (prefers-reduced-motion: reduce) {
  .typing-line .type-char {
    opacity: 1;
    transform: none;
    transition: none;
  }

  .typing-line .type-cursor {
    animation: none;
  }
}

h2 {
  max-width: 860px;
  font-size: clamp(36px, 4.6vw, 72px);
  font-weight: 650;
  line-height: 1.02;
  letter-spacing: 0;
}

h3 {
  font-size: 18px;
  font-weight: 720;
  line-height: 1.22;
}

.lead {
  max-width: 650px;
  margin-top: 30px;
  color: var(--muted);
  font-size: clamp(17px, 1.5vw, 21px);
  line-height: 1.62;
}

.muted,
.card p,
.package-list {
  color: var(--muted);
}

.actions {
  display: flex;
  flex-wrap: wrap;
  gap: 12px;
  margin-top: 36px;
}

.button {
  position: relative;
  display: inline-flex;
  align-items: center;
  justify-content: center;
  min-height: 44px;
  padding: 0 18px;
  border: 1px solid var(--line);
  border-radius: 999px;
  background: var(--ink);
  color: var(--page-bg);
  font-size: 13px;
  font-weight: 720;
  box-shadow: 0 16px 36px rgba(23, 119, 210, 0.16);
}

.button.secondary {
  background: transparent;
  color: var(--ink);
}

.theme-dark .button {
  background: #eef7ff;
  color: #06101f;
}

.theme-dark .button.secondary {
  background: transparent;
  color: #eef7ff;
}

.tilt-wrap {
  position: relative;
  z-index: 3;
  justify-self: end;
  width: min(100%, 640px);
  padding: 54px 30px 74px 42px;
  margin: -54px -30px -74px -42px;
  perspective: 1200px;
  transform-style: preserve-3d;
  overflow: visible;
}

.hero-surface {
  --rx: -7deg;
  --ry: 6deg;
  --scrollPitch: 0deg;
  position: relative;
  min-height: 540px;
  transform: rotateX(calc(var(--rx) + var(--scrollPitch))) rotateY(var(--ry)) translateY(-6px);
  transform-style: preserve-3d;
  transition: transform 220ms ease, box-shadow 220ms ease;
  border: 1px solid var(--line);
  border-radius: 26px;
  background:
    linear-gradient(135deg, rgba(255, 255, 255, 0.18), transparent 34%),
    var(--surface);
  box-shadow:
    0 52px 120px var(--shadow),
    0 0 80px rgba(38, 216, 255, 0.13),
    inset 0 1px 0 rgba(255, 255, 255, 0.24);
  backdrop-filter: blur(24px) saturate(1.35);
  overflow: visible;
}

.hero-surface::before,
.hero-surface::after {
  content: "";
  position: absolute;
  pointer-events: none;
  border-radius: inherit;
}

.hero-surface::before {
  inset: -1px;
  border: 1px solid transparent;
  background: linear-gradient(135deg, var(--glass-edge), rgba(138, 98, 255, 0.1), rgba(210, 85, 232, 0.28)) border-box;
  mask: linear-gradient(#000 0 0) padding-box, linear-gradient(#000 0 0);
  mask-composite: exclude;
}

.hero-surface::after {
  inset: auto 12% -44px;
  height: 88px;
  background: radial-gradient(ellipse, rgba(38, 216, 255, 0.26), transparent 70%);
  filter: blur(20px);
  transform: translateZ(-80px);
}

.hero-antibody-front {
  position: absolute;
  z-index: 18;
  top: 50%;
  right: 0;
  width: 50vw;
  max-width: 900px;
  aspect-ratio: 1 / 1;
  height: auto;
  transform: translateY(-47%);
  pointer-events: none;
  overflow: visible;
}

.hero-antibody-front iframe {
  display: block;
  width: 100%;
  height: 100%;
  border: 0;
  background: transparent !important;
  color-scheme: normal;
}

.float-layer {
  position: absolute;
  transform-style: preserve-3d;
  border: 1px solid var(--line);
  border-radius: 18px;
  background: var(--surface-strong);
  backdrop-filter: blur(18px);
  box-shadow: 0 28px 70px var(--layer-shadow);
}

.layer-main {
  inset: 32px;
  transform: translateZ(44px);
}

.layer-side {
  right: -28px;
  top: 92px;
  width: 38%;
  min-height: 170px;
  transform: translateZ(104px) rotateY(-4deg);
}

.layer-chip {
  left: 34px;
  bottom: 34px;
  display: flex;
  gap: 10px;
  align-items: center;
  min-width: 230px;
  padding: 14px 16px;
  transform: translateZ(156px);
}

.layer-chip::before {
  content: "";
  width: 10px;
  height: 10px;
  border-radius: 999px;
  background: linear-gradient(135deg, var(--cyan), var(--violet));
  box-shadow: 0 0 18px rgba(38, 216, 255, 0.8);
}

.surface-header {
  display: flex;
  justify-content: space-between;
  align-items: center;
  padding: 18px 20px;
  border-bottom: 1px solid var(--line);
  color: var(--soft);
  font-size: 12px;
  font-weight: 720;
  transform: translateZ(18px);
}

.surface-body {
  display: grid;
  grid-template-columns: 0.74fr 1fr;
  gap: 22px;
  padding: 24px;
  transform: translateZ(28px);
  transform-style: preserve-3d;
}

.factory-body {
  display: block;
  min-height: 396px;
  padding: 20px 28px 22px;
}

.factory-flow {
  position: relative;
  min-height: 356px;
  overflow: visible;
  border: 1px solid var(--line);
  border-radius: 18px;
  background:
    radial-gradient(circle at 22% 42%, rgba(38, 216, 255, 0.18), transparent 24%),
    radial-gradient(circle at 56% 44%, rgba(138, 98, 255, 0.16), transparent 22%),
    radial-gradient(circle at 84% 44%, rgba(236, 59, 157, 0.12), transparent 24%),
    linear-gradient(var(--grid) 1px, transparent 1px),
    linear-gradient(90deg, var(--grid) 1px, transparent 1px),
    rgba(255, 255, 255, 0.05);
  background-size: auto, auto, auto, 32px 32px, 32px 32px, auto;
  transform: translateZ(68px);
}

.factory-workflow {
  display: grid;
  grid-template-columns: repeat(5, minmax(0, 1fr));
  gap: 8px;
  min-height: 356px;
  padding: 46px 12px 12px;
  overflow: visible;
}

.factory-workflow::before {
  content: "Workflow";
  position: absolute;
  left: 16px;
  top: 12px;
  z-index: 4;
  padding: 8px 14px;
  border: 1px solid rgba(0, 194, 181, 0.32);
  border-radius: 999px;
  color: #13bfb8;
  background: rgba(255, 255, 255, 0.72);
  font-size: 11px;
  font-weight: 850;
  letter-spacing: 0.05em;
}

html[lang="zh-CN"] .factory-workflow::before {
  content: "Workflow";
}

.theme-dark .factory-workflow::before {
  background: rgba(9, 20, 39, 0.76);
}

.workflow-link {
  position: absolute;
  left: 12%;
  right: 12%;
  top: 51%;
  z-index: 1;
  height: 2px;
  background: linear-gradient(90deg, transparent, rgba(38, 216, 255, 0.46), rgba(138, 98, 255, 0.52), rgba(0, 217, 181, 0.42), transparent);
  box-shadow: 0 0 18px rgba(38, 216, 255, 0.28);
}

.workflow-link::after {
  content: "";
  position: absolute;
  inset: -5px 0;
  background: linear-gradient(90deg, transparent, rgba(255, 255, 255, 0.72), transparent);
  animation: conveyorSweep 4.8s linear infinite;
}

.factory-stage {
  position: relative;
  z-index: 2;
  display: grid;
  grid-template-rows: 34px 54px 1fr;
  justify-items: center;
  align-items: stretch;
  gap: 6px;
  height: 294px;
  padding: 26px 9px 9px;
  overflow: visible;
  border: 1px solid rgba(0, 194, 181, 0.34);
  border-radius: 14px;
  background:
    linear-gradient(180deg, rgba(255, 255, 255, 0.72), rgba(248, 253, 255, 0.5)),
    rgba(255, 255, 255, 0.08);
  box-shadow:
    inset 0 1px 0 rgba(255, 255, 255, 0.38),
    0 22px 46px rgba(23, 119, 210, 0.08);
}

.stage-cho,
.stage-data {
  justify-items: center;
}

.stage-cho {
  overflow: visible;
}

.stage-cho .bio-process {
  width: min(100%, 86px);
  justify-self: center;
}

.stage-data .data-engine {
  justify-self: center;
  align-self: center;
  margin: 0 auto;
  transform: translateX(0);
}

.stage-data {
  overflow: hidden;
}

.theme-dark .factory-stage {
  background:
    linear-gradient(180deg, rgba(13, 33, 60, 0.86), rgba(8, 19, 37, 0.62)),
    rgba(8, 18, 35, 0.72);
}

.stage-tag {
  align-self: center;
  justify-self: center;
  display: inline-flex;
  align-items: start;
  justify-content: center;
  max-width: min(100%, 86px);
  min-height: 25px;
  padding: 5px 7px;
  border: 1px solid var(--line);
  border-radius: 999px;
  color: #10bdb5;
  background: rgba(255, 255, 255, 0.74);
  font-size: 8px;
  font-weight: 850;
  line-height: 1.05;
  text-align: center;
  text-transform: uppercase;
  white-space: normal;
  overflow-wrap: normal;
  word-break: keep-all;
}

.theme-dark .stage-tag {
  background: rgba(255, 255, 255, 0.08);
}

.factory-stage h4 {
  display: flex;
  align-items: center;
  justify-content: center;
  align-self: stretch;
  width: 100%;
  margin: 0;
  color: var(--card-text);
  font-size: clamp(12px, 1vw, 15px);
  line-height: 1.08;
  text-align: center;
  overflow-wrap: normal;
  word-break: keep-all;
  hyphens: none;
}

.sequence-stack {
  display: grid;
  gap: 5px;
  align-content: start;
  padding-top: 4px;
  mask-image: linear-gradient(180deg, transparent, black 12%, black 86%, transparent);
}

.sequence-stack span {
  min-height: 20px;
  padding: 5px 7px;
  border: 1px solid rgba(0, 194, 181, 0.25);
  border-radius: 9px;
  color: var(--card-text);
  background: rgba(255, 255, 255, 0.56);
  font-size: 8px;
  font-weight: 740;
  transform-origin: left center;
  animation: sequenceRows 4.8s ease-in-out infinite;
}

.theme-dark .sequence-stack span {
  background: rgba(255, 255, 255, 0.07);
}

.sequence-stack span:nth-child(2) { animation-delay: 0.12s; }
.sequence-stack span:nth-child(3) { animation-delay: 0.24s; }
.sequence-stack span:nth-child(4) { animation-delay: 0.36s; }
.sequence-stack span:nth-child(5) { animation-delay: 0.48s; }

.bio-process,
.antibody-showcase {
  position: relative;
  display: grid;
  place-items: center;
  align-self: center;
  width: 100%;
  min-height: 104px;
  overflow: visible;
}

.bio-process strong,
.purity-badge,
.data-engine strong {
  position: relative;
  z-index: 3;
  padding: 5px 7px;
  border: 1px solid rgba(0, 194, 181, 0.28);
  border-radius: 999px;
  color: #0fbab2;
  background: rgba(255, 255, 255, 0.78);
  font-size: 7px;
  font-weight: 850;
  line-height: 1.1;
  text-align: center;
  box-shadow: 0 8px 20px rgba(0, 194, 181, 0.12);
}

.theme-dark .bio-process strong,
.theme-dark .purity-badge,
.theme-dark .data-engine strong {
  background: rgba(9, 20, 39, 0.82);
}

.vector-ring {
  position: absolute;
  left: 8px;
  top: 26%;
  width: 22px;
  height: 22px;
  border: 3px solid rgba(18, 190, 181, 0.72);
  border-radius: 999px;
  box-shadow:
    27px 6px 0 -2px rgba(18, 190, 181, 0.18),
    46px 1px 0 -1px rgba(18, 190, 181, 0.22);
}

.process-arrow {
  position: absolute;
  left: 26px;
  right: 26px;
  top: 52%;
  height: 2px;
  background: linear-gradient(90deg, rgba(18, 190, 181, 0.1), rgba(18, 190, 181, 0.8));
}

.process-arrow::after {
  content: "";
  position: absolute;
  right: -2px;
  top: -4px;
  border-left: 9px solid rgba(18, 190, 181, 0.8);
  border-top: 5px solid transparent;
  border-bottom: 5px solid transparent;
}

.flask-set {
  position: absolute;
  right: 6px;
  top: 27%;
  width: 32px;
  height: 34px;
  background:
    linear-gradient(180deg, transparent 0 30%, rgba(18, 190, 181, 0.34) 31%) 1px 6px / 8px 26px no-repeat,
    linear-gradient(180deg, transparent 0 30%, rgba(18, 190, 181, 0.34) 31%) 12px 0 / 8px 32px no-repeat,
    linear-gradient(180deg, transparent 0 30%, rgba(18, 190, 181, 0.34) 31%) 23px 6px / 8px 26px no-repeat;
}

.flask-set::before {
  content: "";
  position: absolute;
  inset: 0;
  background:
    linear-gradient(rgba(12, 28, 49, 0.58), rgba(12, 28, 49, 0.58)) 1px 6px / 8px 3px no-repeat,
    linear-gradient(rgba(12, 28, 49, 0.58), rgba(12, 28, 49, 0.58)) 12px 0 / 8px 3px no-repeat,
    linear-gradient(rgba(12, 28, 49, 0.58), rgba(12, 28, 49, 0.58)) 23px 6px / 8px 3px no-repeat;
}

.hero-antibody {
  width: 58px;
  height: 80px;
  background: url("data:image/svg+xml,%3Csvg width='78' height='112' viewBox='0 0 78 112' xmlns='http://www.w3.org/2000/svg'%3E%3Cdefs%3E%3ClinearGradient id='g' x1='0' y1='0' x2='1' y2='1'%3E%3Cstop offset='0' stop-color='%23245fd5'/%3E%3Cstop offset='.42' stop-color='%23c7e4ff'/%3E%3Cstop offset='1' stop-color='%23355bdd'/%3E%3C/linearGradient%3E%3ClinearGradient id='h' x1='0' y1='0' x2='1' y2='1'%3E%3Cstop offset='0' stop-color='%233464dd'/%3E%3Cstop offset='1' stop-color='%23233aa6'/%3E%3C/linearGradient%3E%3C/defs%3E%3Cg stroke-linecap='round' stroke-linejoin='round'%3E%3Cpath d='M39 38v62' stroke='%23d8ecff' stroke-width='19'/%3E%3Cpath d='M39 38v62' stroke='url(%23g)' stroke-width='13'/%3E%3Cpath d='M39 38L17 14' stroke='%23d8ecff' stroke-width='19'/%3E%3Cpath d='M39 38L17 14' stroke='url(%23g)' stroke-width='13'/%3E%3Cpath d='M39 38L61 14' stroke='%23d8ecff' stroke-width='19'/%3E%3Cpath d='M39 38L61 14' stroke='url(%23g)' stroke-width='13'/%3E%3Cpath d='M19 14L8 4' stroke='url(%23h)' stroke-width='13'/%3E%3Cpath d='M59 14L70 4' stroke='url(%23h)' stroke-width='13'/%3E%3Cpath d='M39 82v22' stroke='url(%23h)' stroke-width='13'/%3E%3Cpath d='M25 43h28' stroke='%23d36a40' stroke-width='3'/%3E%3C/g%3E%3C/svg%3E") center / contain no-repeat;
}

.purity-badge {
  position: absolute;
  right: 0;
  bottom: 0;
}

.data-engine strong {
  position: absolute;
  left: 50%;
  bottom: 8px;
  max-width: 62px;
  white-space: nowrap;
  transform: translateX(-50%);
}

.ai-card span {
  display: block;
  width: 78%;
  min-height: 10px;
  height: auto;
  padding: 5px 7px;
  color: var(--card-text);
  font-size: 8px;
  font-weight: 800;
  line-height: 1;
  animation: none;
}

.antibody-radar,
.assay-orbit {
  position: relative;
  align-self: center;
  justify-self: center;
  width: min(104px, 100%);
  aspect-ratio: 1;
  border: 2px dashed rgba(0, 194, 181, 0.42);
  border-radius: 999px;
}

.antibody-radar {
  animation: radarSpin 9s linear infinite;
}

.assay-orbit {
  animation: orbitBreath 4.8s ease-in-out infinite;
}

.antibody-mark {
  position: absolute;
  left: 50%;
  top: 50%;
  z-index: 2;
  width: 38px;
  height: 38px;
  transform: translate(-50%, -50%);
}

.antibody-mark::before,
.antibody-mark::after {
  content: "";
  position: absolute;
  top: 10px;
  width: 22px;
  height: 8px;
  border-radius: 999px;
  background: linear-gradient(90deg, var(--blue), var(--cyan), var(--violet));
}

.antibody-mark::before {
  left: 7px;
  transform: rotate(44deg);
}

.antibody-mark::after {
  right: 7px;
  transform: rotate(136deg);
}

.metric {
  position: absolute;
  padding: 4px 7px;
  border: 1px solid rgba(0, 194, 181, 0.36);
  border-radius: 999px;
  color: var(--card-text);
  background: rgba(255, 255, 255, 0.75);
  font-size: 9px;
  font-weight: 850;
  animation: metricGlow 4.8s ease-in-out infinite;
}

.theme-dark .metric {
  background: rgba(9, 20, 39, 0.82);
}

.metric.kd { left: 34%; top: -13px; }
.metric.kd2 { right: -8px; top: 18%; }
.metric.ka { right: -9px; bottom: 14%; }
.metric.dsf { left: -12px; bottom: 18%; }
.metric.ac { left: -18px; top: 24%; }
.metric.psr { left: 38%; bottom: -13px; }

.metric.kd2 { animation-delay: 0.18s; }
.metric.ka { animation-delay: 0.36s; }
.metric.dsf { animation-delay: 0.54s; }
.metric.ac { animation-delay: 0.72s; }
.metric.psr { animation-delay: 0.9s; }

.antigen-dot {
  position: absolute;
  right: 18%;
  top: 45%;
  width: 28px;
  height: 28px;
  border-radius: 999px;
  border: 6px solid rgba(97, 220, 149, 0.82);
  animation: antigenCollision 4.8s ease-in-out infinite;
}

.collision-flash {
  position: absolute;
  left: 56%;
  top: 50%;
  width: 18px;
  height: 18px;
  border-radius: 999px;
  background: rgba(38, 216, 255, 0.6);
  transform: translate(-50%, -50%);
  animation: collisionFlash 4.8s ease-in-out infinite;
}

.data-engine {
  position: relative;
  align-self: center;
  justify-self: center;
  display: flex;
  align-items: end;
  gap: 6px;
  width: min(74px, 88%);
  height: 98px;
  padding: 20px 10px 26px;
  border-radius: 12px;
  background: #21494a;
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.16);
}

.data-engine i {
  width: 9px;
  border-radius: 999px;
  background: linear-gradient(180deg, #6de196, #12beb7);
  animation: dataBars 4.8s ease-in-out infinite;
}

.data-engine i:nth-child(1) { height: 32px; }
.data-engine i:nth-child(2) { height: 48px; animation-delay: 0.16s; }
.data-engine i:nth-child(3) { height: 37px; animation-delay: 0.32s; }
.data-engine i:nth-child(4) { height: 56px; animation-delay: 0.48s; }

.mini-line {
  position: absolute;
  left: 12px;
  right: 12px;
  bottom: 18px;
  height: 24px;
  background:
    radial-gradient(circle at 25% 78%, #f5fbff 0 4px, #6ea3ff 4px 7px, transparent 7px),
    radial-gradient(circle at 67% 45%, #f5fbff 0 4px, #6ea3ff 4px 7px, transparent 7px),
    radial-gradient(circle at 100% 10%, #f5fbff 0 4px, #6ea3ff 4px 7px, transparent 7px),
    linear-gradient(150deg, transparent 0 20%, #6ea3ff 21% 26%, transparent 27% 41%, #6ea3ff 42% 47%, transparent 48% 59%, #6ea3ff 60% 65%, transparent 66% 75%, #6ea3ff 76% 81%, transparent 82%);
  background-size: 100% 100%;
  animation: chartCrawl 2.8s linear infinite;
}

.ai-card {
  position: relative;
  align-self: center;
  justify-self: center;
  display: grid;
  justify-items: center;
  align-content: center;
  gap: 7px;
  width: min(72px, 92%);
  min-height: 104px;
  border: 1px solid var(--line);
  border-radius: 14px;
  background:
    radial-gradient(circle at 50% 30%, rgba(104, 163, 255, 0.22), transparent 42%),
    rgba(255, 255, 255, 0.55);
}

.theme-dark .ai-card {
  background:
    radial-gradient(circle at 50% 30%, rgba(104, 163, 255, 0.2), transparent 42%),
    rgba(255, 255, 255, 0.08);
}

.ai-card strong {
  display: grid;
  place-items: center;
  width: 44px;
  height: 44px;
  border: 3px solid #18beb5;
  border-radius: 20px;
  color: var(--card-text);
  font-size: 18px;
  box-shadow: 0 0 24px rgba(24, 190, 181, 0.22);
  animation: aiPulse 4.8s ease-in-out infinite;
}

.ai-card span {
  display: block;
  width: 82%;
  min-height: 8px;
  height: auto;
  padding: 4px 6px;
  border-radius: 999px;
  color: var(--card-text);
  background: rgba(0, 194, 181, 0.18);
  font-size: 7px;
  font-weight: 800;
  line-height: 1;
  text-align: center;
  animation: none;
}

.ai-card span:nth-child(3) { width: 68%; animation-delay: 0.18s; }
.ai-card span:nth-child(4) { width: 74%; animation-delay: 0.34s; }

.hero-workflow-3 {
  grid-template-columns: minmax(0, 1fr) 34px minmax(0, 1.02fr) 34px minmax(0, 1.05fr);
  gap: 0;
  padding: 46px 14px 44px;
  overflow: hidden;
}

.hero-workflow-3 .workflow-link {
  left: 10%;
  right: 10%;
  top: 50%;
}

.hero-flow-card {
  position: relative;
  z-index: 2;
  display: grid;
  grid-template-rows: auto 1fr auto;
  align-items: center;
  min-width: 0;
  height: 292px;
  padding: 14px 10px 10px;
  overflow: hidden;
  border: 1px solid rgba(0, 194, 181, 0.34);
  border-radius: 14px;
  background:
    linear-gradient(180deg, rgba(255, 255, 255, 0.74), rgba(248, 253, 255, 0.5)),
    rgba(255, 255, 255, 0.08);
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.38);
}

.theme-dark .hero-flow-card {
  background:
    linear-gradient(180deg, rgba(13, 33, 60, 0.88), rgba(8, 19, 37, 0.62)),
    rgba(8, 18, 35, 0.72);
}

.mini-step {
  display: grid;
  grid-template-columns: 24px 1fr;
  gap: 7px;
  align-items: center;
  min-height: 46px;
  color: #0b43d4;
  font-size: clamp(9px, 0.68vw, 11px);
  font-weight: 900;
  line-height: 1.08;
  text-align: left;
}

.theme-dark .mini-step {
  color: #d8ebff;
}

.mini-step span {
  display: grid;
  place-items: center;
  width: 23px;
  height: 23px;
  border-radius: 999px;
  color: #fff;
  background: linear-gradient(135deg, #155df6, #06a8ff);
  box-shadow: 0 8px 16px rgba(22, 93, 246, 0.26);
}

.hero-flow-card p {
  align-self: end;
  max-width: 160px;
  margin: 7px auto 0;
  color: #0b43d4;
  font-size: clamp(7px, 0.55vw, 9px);
  font-weight: 850;
  line-height: 1.18;
  text-align: center;
}

.theme-dark .hero-flow-card p {
  color: #d8ebff;
}

.hero-sequence-window {
  position: relative;
  align-self: stretch;
  width: 100%;
  min-height: 154px;
  margin: 6px 0 0;
  overflow: hidden;
  border: 1px solid rgba(87, 158, 255, 0.24);
  border-radius: 10px;
  background:
    linear-gradient(180deg, rgba(255, 255, 255, 0.72), rgba(255, 255, 255, 0.28)),
    linear-gradient(90deg, rgba(53, 129, 255, 0.13), transparent);
}

.hero-sequence-window::before,
.hero-sequence-window::after {
  content: "";
  position: absolute;
  top: 8px;
  z-index: 1;
  width: 12px;
  height: 52px;
  border-radius: 999px;
  background: linear-gradient(180deg, transparent, rgba(43, 130, 255, 0.78), transparent);
  animation: floatArrow 2.8s ease-in-out infinite;
}

.hero-sequence-window::before { left: 42%; }
.hero-sequence-window::after { right: 16%; animation-delay: 0.7s; }

.hero-sequence-stream {
  display: grid;
  gap: 8px;
  padding: 46px 10px 12px;
  animation: sequenceFloat 8s linear infinite;
}

.hero-sequence-stream .sequence-row {
  grid-template-columns: 20px 1fr;
  gap: 7px;
  min-height: 42px;
  padding: 8px;
}

.hero-sequence-stream .sequence-row b {
  width: 18px;
  height: 18px;
}

.hero-sequence-stream .sequence-row span {
  font-size: 6px;
}

.hero-data-bridge {
  position: relative;
  z-index: 1;
  height: 100%;
}

.hero-data-bridge span {
  position: absolute;
  left: -6px;
  right: -6px;
  top: 50%;
  height: 38px;
  border-radius: 999px;
  background:
    repeating-linear-gradient(90deg, transparent 0 13px, rgba(255, 255, 255, 0.78) 14px 16px, transparent 17px 27px),
    linear-gradient(90deg, rgba(67, 150, 255, 0.08), rgba(67, 150, 255, 0.42), rgba(67, 150, 255, 0.08));
  transform: translateY(-50%);
  animation: dataPulse 2.8s linear infinite;
}

.hero-data-bridge::after {
  content: "";
  position: absolute;
  right: -8px;
  top: 50%;
  border-top: 11px solid transparent;
  border-bottom: 11px solid transparent;
  border-left: 16px solid #2788ff;
  filter: drop-shadow(0 0 12px rgba(39, 136, 255, 0.42));
  transform: translateY(-50%);
}

.hero-orbit {
  position: relative;
  align-self: center;
  justify-self: center;
  width: min(172px, 94%);
  aspect-ratio: 1;
  border: 2px solid rgba(82, 150, 255, 0.18);
  border-radius: 999px;
  background:
    radial-gradient(circle at center, rgba(255, 255, 255, 0.8) 0 24%, transparent 25%),
    conic-gradient(from 0deg, rgba(66, 140, 255, 0.08), rgba(66, 140, 255, 0.35), rgba(66, 140, 255, 0.08));
}

.hero-orbit::after {
  content: "";
  position: absolute;
  inset: 13px;
  border: 1px dashed rgba(55, 139, 255, 0.42);
  border-radius: inherit;
  animation: orbitSpin 10s linear infinite;
}

.hero-center-antibody {
  position: absolute;
  left: 50%;
  top: 50%;
  z-index: 2;
  width: 66px;
  height: 94px;
  transform: translate(-50%, -50%);
  filter: drop-shadow(0 10px 16px rgba(24, 96, 215, 0.24));
  animation: antibodyFloat 4s ease-in-out infinite;
}

.hero-orbit .orbit-label {
  min-width: 34px;
  min-height: 20px;
  padding: 3px 6px;
  font-size: 8px;
}

.hero-orbit .orbit-label.kd { top: -8px; }
.hero-orbit .orbit-label.ka { left: -3px; top: 32%; }
.hero-orbit .orbit-label.koff { right: -4px; top: 32%; }
.hero-orbit .orbit-label.dsf { right: 6%; top: 8%; }
.hero-orbit .orbit-label.ac { left: -4px; bottom: 14%; }
.hero-orbit .orbit-label.psr { right: 7%; bottom: 14%; }

.hero-dashboard {
  width: 100%;
  margin: 2px 0 0;
  padding: 9px;
  border-radius: 10px;
  transform: none;
}

.hero-dashboard .dash-header {
  margin-bottom: 6px;
  font-size: 8px;
}

.hero-dashboard .dash-grid {
  grid-template-columns: repeat(2, minmax(0, 1fr));
  gap: 6px;
}

.hero-dashboard .dash-tile {
  min-height: 48px;
  padding: 6px;
}

.hero-dashboard .dash-tile small {
  font-size: 6px;
}

.hero-dashboard .dash-tile b {
  margin-top: 2px;
  font-size: 7px;
}

.hero-dashboard .sparkline,
.hero-dashboard .mini-bars {
  height: 22px;
  margin-top: 4px;
}

.hero-model-loop {
  position: absolute;
  left: 50%;
  bottom: 10px;
  z-index: 3;
  display: grid;
  grid-template-columns: auto 34px;
  gap: 10px;
  align-items: center;
  width: min(270px, 52%);
  padding: 7px 12px;
  border-radius: 999px;
  color: #0b43d4;
  background: rgba(255, 255, 255, 0.86);
  box-shadow: 0 12px 28px rgba(42, 122, 255, 0.13);
  transform: translateX(-50%);
}

.theme-dark .hero-model-loop {
  color: #d8ebff;
  background: rgba(8, 28, 52, 0.86);
}

.hero-model-loop strong {
  font-size: 8px;
  line-height: 1.05;
}

.hero-model-loop span {
  width: 28px;
  height: 20px;
  border-radius: 6px;
  background:
    linear-gradient(#1d6fff, #1d6fff) 8px 3px / 12px 4px no-repeat,
    linear-gradient(#1d6fff, #1d6fff) 5px 8px / 18px 4px no-repeat,
    linear-gradient(#1d6fff, #1d6fff) 8px 13px / 12px 4px no-repeat;
}

.factory-workflow .flow-token { top: calc(51% - 7px); }
.factory-workflow .token-sequence { left: 13%; }
.factory-workflow .token-antibody { left: 31%; }
.factory-workflow .token-antigen { right: 42%; }
.factory-workflow .token-data { left: 54%; }
.factory-workflow .token-return { top: 88%; }

.factory-track,
.return-track {
  position: absolute;
  left: 9%;
  right: 9%;
  height: 2px;
  border-radius: 999px;
  background: linear-gradient(90deg, transparent, var(--cyan), var(--violet), var(--magenta), transparent);
  box-shadow: 0 0 22px rgba(38, 216, 255, 0.34);
}

.factory-track {
  top: 47%;
}

.return-track {
  top: 76%;
  opacity: 0.54;
  background: linear-gradient(270deg, transparent, rgba(38, 216, 255, 0.85), rgba(0, 217, 181, 0.72), transparent);
}

.factory-track::before,
.return-track::before {
  content: "";
  position: absolute;
  inset: -5px 0;
  background: linear-gradient(90deg, transparent, rgba(255, 255, 255, 0.55), transparent);
  animation: conveyorSweep 4.8s linear infinite;
}

.return-track::before {
  animation-name: conveyorSweepBack;
}

.factory-node {
  position: absolute;
  top: 30%;
  display: grid;
  justify-items: center;
  gap: 10px;
  width: 88px;
  transform: translateX(-50%);
  color: var(--card-muted);
  font-size: 11px;
  font-weight: 760;
}

.node-dna {
  left: 10%;
  animation: nodePulse 4.8s ease-in-out infinite;
}

.node-antibody {
  left: 32%;
  animation: nodePulse 4.8s ease-in-out 0.8s infinite;
}

.node-collision {
  left: 52%;
  animation: collisionPulse 4.8s ease-in-out infinite;
}

.node-data {
  left: 72%;
  animation: nodePulse 4.8s ease-in-out 2.4s infinite;
}

.node-ai {
  left: 90%;
  animation: nodePulse 4.8s ease-in-out 3.1s infinite;
}

.node-icon {
  position: relative;
  display: block;
  width: 54px;
  height: 54px;
  border: 1px solid var(--line);
  border-radius: 16px;
  background:
    linear-gradient(135deg, rgba(255, 255, 255, 0.18), transparent),
    rgba(255, 255, 255, 0.08);
  box-shadow:
    0 18px 34px rgba(23, 119, 210, 0.14),
    inset 0 1px 0 rgba(255, 255, 255, 0.2);
}

.dna-glyph::before,
.dna-glyph::after {
  content: "";
  position: absolute;
  top: 10px;
  bottom: 10px;
  width: 15px;
  border: 2px solid var(--cyan);
  border-left: 0;
  border-radius: 50%;
}

.dna-glyph::before {
  left: 13px;
  transform: skewY(-18deg);
}

.dna-glyph::after {
  right: 13px;
  transform: skewY(18deg);
  border-color: var(--violet);
}

.antibody-glyph::before,
.antibody-glyph::after {
  content: "";
  position: absolute;
  top: 13px;
  width: 22px;
  height: 10px;
  border-radius: 999px;
  background: linear-gradient(90deg, var(--cyan), var(--violet));
  transform-origin: right center;
}

.antibody-glyph::before {
  left: 8px;
  transform: rotate(44deg);
}

.antibody-glyph::after {
  right: 8px;
  transform: rotate(136deg);
}

.antibody-glyph {
  background:
    radial-gradient(circle at 50% 65%, rgba(38, 216, 255, 0.28), transparent 24%),
    rgba(255, 255, 255, 0.08);
}

.collision-glyph::before,
.collision-glyph::after {
  content: "";
  position: absolute;
  top: 22px;
  width: 18px;
  height: 18px;
  border-radius: 999px;
}

.collision-glyph::before {
  left: 10px;
  background: var(--cyan);
  box-shadow: 0 0 18px rgba(38, 216, 255, 0.6);
}

.collision-glyph::after {
  right: 10px;
  background: var(--magenta);
  box-shadow: 0 0 18px rgba(236, 59, 157, 0.5);
}

.data-glyph::before {
  content: "";
  position: absolute;
  left: 13px;
  right: 13px;
  bottom: 13px;
  height: 26px;
  background:
    linear-gradient(90deg, var(--cyan) 0 18%, transparent 18% 31%, var(--violet) 31% 49%, transparent 49% 63%, var(--magenta) 63% 82%, transparent 82%);
}

.ai-glyph::before,
.ai-glyph::after {
  content: "";
  position: absolute;
  border-radius: 999px;
}

.ai-glyph::before {
  inset: 13px;
  border: 2px solid var(--cyan);
  box-shadow: 0 0 18px rgba(38, 216, 255, 0.38);
}

.ai-glyph::after {
  inset: 24px;
  background: var(--violet);
  box-shadow:
    -18px -12px 0 -4px var(--cyan),
    18px -12px 0 -4px var(--magenta),
    -18px 12px 0 -4px var(--violet),
    18px 12px 0 -4px var(--cyan);
}

.flow-token {
  position: absolute;
  z-index: 2;
  display: block;
  width: 16px;
  height: 16px;
  border-radius: 999px;
  background: var(--cyan);
  box-shadow: 0 0 20px rgba(38, 216, 255, 0.7);
}

.token-sequence {
  top: calc(47% - 8px);
  left: 8%;
  animation: sequenceToken 4.8s cubic-bezier(0.4, 0, 0.2, 1) infinite;
}

.token-antibody {
  top: calc(47% - 9px);
  left: 28%;
  width: 18px;
  height: 18px;
  background: var(--violet);
  animation: antibodyToken 4.8s cubic-bezier(0.4, 0, 0.2, 1) infinite;
}

.token-antigen {
  top: calc(47% - 7px);
  right: 41%;
  width: 14px;
  height: 14px;
  background: var(--magenta);
  animation: antigenToken 4.8s cubic-bezier(0.4, 0, 0.2, 1) infinite;
}

.token-data {
  top: calc(47% - 6px);
  left: 52%;
  width: 12px;
  height: 12px;
  background: linear-gradient(135deg, var(--cyan), var(--violet));
}

.token-data-a {
  animation: dataToken 4.8s cubic-bezier(0.4, 0, 0.2, 1) 0.08s infinite;
}

.token-data-b {
  animation: dataToken 4.8s cubic-bezier(0.4, 0, 0.2, 1) 0.22s infinite;
}

.token-return {
  top: calc(76% - 7px);
  right: 10%;
  width: 14px;
  height: 14px;
  background: #00d9b5;
  animation: returnToken 4.8s cubic-bezier(0.4, 0, 0.2, 1) infinite;
}

.factory-readout {
  display: grid;
  align-content: center;
  gap: 14px;
  padding: 22px;
}

.factory-readout span {
  display: block;
  height: 12px;
  border-radius: 999px;
  background: linear-gradient(90deg, rgba(38, 216, 255, 0.72), rgba(138, 98, 255, 0.3), transparent);
  animation: readoutBars 4.8s ease-in-out infinite;
}

.factory-readout span:nth-child(2) {
  width: 76%;
  animation-delay: 0.2s;
}

.factory-readout span:nth-child(3) {
  width: 58%;
  animation-delay: 0.4s;
}

@keyframes conveyorSweep {
  from {
    transform: translateX(-32%);
  }

  to {
    transform: translateX(88%);
  }
}

@keyframes conveyorSweepBack {
  from {
    transform: translateX(88%);
  }

  to {
    transform: translateX(-32%);
  }
}

@keyframes nodePulse {
  0%,
  100% {
    transform: translateX(-50%) translateY(0) scale(1);
  }

  45%,
  62% {
    transform: translateX(-50%) translateY(-4px) scale(1.05);
  }
}

@keyframes collisionPulse {
  0%,
  44%,
  72%,
  100% {
    transform: translateX(-50%) scale(1);
    filter: none;
  }

  55% {
    transform: translateX(-50%) scale(1.12);
    filter: drop-shadow(0 0 20px rgba(38, 216, 255, 0.8));
  }
}

@keyframes sequenceToken {
  0% {
    opacity: 0;
    transform: translateX(0) scale(0.7);
  }

  10%,
  26% {
    opacity: 1;
  }

  40% {
    opacity: 1;
    transform: translateX(25vw) scale(1);
  }

  45%,
  100% {
    opacity: 0;
    transform: translateX(25vw) scale(0.5);
  }
}

@keyframes antibodyToken {
  0%,
  18% {
    opacity: 0;
    transform: translateX(0) scale(0.7);
  }

  28%,
  52% {
    opacity: 1;
  }

  58% {
    opacity: 1;
    transform: translateX(16vw) scale(1.15);
  }

  64%,
  100% {
    opacity: 0;
    transform: translateX(16vw) scale(0.4);
  }
}

@keyframes antigenToken {
  0%,
  28% {
    opacity: 0;
    transform: translateX(0) scale(0.7);
  }

  42%,
  55% {
    opacity: 1;
  }

  58% {
    opacity: 1;
    transform: translateX(-8vw) scale(1.12);
  }

  64%,
  100% {
    opacity: 0;
    transform: translateX(-8vw) scale(0.4);
  }
}

@keyframes dataToken {
  0%,
  54% {
    opacity: 0;
    transform: translateX(0) scale(0.5);
  }

  62%,
  82% {
    opacity: 1;
  }

  92% {
    opacity: 1;
    transform: translateX(25vw) scale(1);
  }

  100% {
    opacity: 0;
    transform: translateX(25vw) scale(0.6);
  }
}

@keyframes returnToken {
  0%,
  70% {
    opacity: 0;
    transform: translateX(0) scale(0.7);
  }

  78%,
  92% {
    opacity: 1;
  }

  100% {
    opacity: 0;
    transform: translateX(-62vw) scale(1);
  }
}

@keyframes readoutBars {
  0%,
  48%,
  100% {
    opacity: 0.34;
    transform: scaleX(0.45);
    transform-origin: left center;
  }

  64%,
  82% {
    opacity: 1;
    transform: scaleX(1);
  }
}

@keyframes sequenceRows {
  0%,
  100% {
    opacity: 0.52;
    transform: translateY(8px) scaleX(0.92);
  }

  18%,
  66% {
    opacity: 1;
    transform: translateY(0) scaleX(1);
    box-shadow: 0 0 18px rgba(38, 216, 255, 0.16);
  }

  84% {
    opacity: 0.42;
    transform: translateY(-8px) scaleX(0.96);
  }
}

@keyframes radarSpin {
  from {
    transform: rotate(0deg);
  }

  to {
    transform: rotate(360deg);
  }
}

@keyframes metricGlow {
  0%,
  100% {
    opacity: 0.62;
    box-shadow: none;
  }

  44%,
  58% {
    opacity: 1;
    box-shadow: 0 0 18px rgba(38, 216, 255, 0.28);
  }
}

@keyframes orbitBreath {
  0%,
  100% {
    transform: scale(0.96);
    box-shadow: inset 0 0 0 rgba(0, 194, 181, 0);
  }

  50% {
    transform: scale(1.04);
    box-shadow: inset 0 0 28px rgba(0, 194, 181, 0.14);
  }
}

@keyframes antigenCollision {
  0%,
  24%,
  100% {
    opacity: 0.76;
    transform: translateX(0) scale(0.86);
  }

  48%,
  58% {
    opacity: 1;
    transform: translateX(-30px) scale(1.08);
  }

  72% {
    opacity: 0.7;
    transform: translateX(8px) scale(0.9);
  }
}

@keyframes collisionFlash {
  0%,
  42%,
  70%,
  100% {
    opacity: 0;
    transform: translate(-50%, -50%) scale(0.4);
  }

  54% {
    opacity: 1;
    transform: translate(-50%, -50%) scale(2.8);
    box-shadow: 0 0 36px rgba(38, 216, 255, 0.72);
  }
}

@keyframes dataBars {
  0%,
  100% {
    transform: scaleY(0.58);
    opacity: 0.58;
  }

  38% {
    transform: scaleY(1.08);
    opacity: 1;
  }

  68% {
    transform: scaleY(0.78);
    opacity: 0.82;
  }
}

@keyframes chartCrawl {
  from {
    background-position: 0 0;
    opacity: 0.7;
  }

  to {
    background-position: 64px 0;
    opacity: 1;
  }
}

@keyframes aiPulse {
  0%,
  100% {
    transform: scale(1);
    box-shadow: 0 0 20px rgba(24, 190, 181, 0.18);
  }

  52% {
    transform: scale(1.07);
    box-shadow: 0 0 34px rgba(38, 216, 255, 0.34);
  }
}

@keyframes feedbackBars {
  0%,
  100% {
    opacity: 0.42;
    transform: scaleX(0.48);
    transform-origin: left center;
  }

  48%,
  70% {
    opacity: 1;
    transform: scaleX(1);
  }
}

.mini-stack {
  display: grid;
  gap: 12px;
  transform-style: preserve-3d;
}

.mini-card,
.dash-card {
  border: 1px solid var(--line);
  border-radius: 14px;
  background: rgba(255, 255, 255, 0.08);
}

.theme-white .mini-card,
.theme-white .dash-card {
  background: rgba(248, 251, 255, 0.82);
}

.mini-card {
  min-height: 68px;
  transform-style: preserve-3d;
}

.mini-card:nth-child(1) {
  transform: translateZ(16px);
}

.mini-card:nth-child(2) {
  transform: translateZ(34px);
}

.mini-card:nth-child(3) {
  transform: translateZ(52px);
}

.chart {
  position: relative;
  min-height: 274px;
  overflow: hidden;
  border: 1px solid var(--line);
  border-radius: 16px;
  transform: translateZ(62px);
  background:
    linear-gradient(var(--grid) 1px, transparent 1px),
    linear-gradient(90deg, var(--grid) 1px, transparent 1px);
  background-size: 30px 30px;
}

.chart::before,
.chart::after {
  content: "";
  position: absolute;
  left: 8%;
  right: 8%;
  height: 2px;
  border-radius: 999px;
}

.chart::before {
  top: 42%;
  background: linear-gradient(90deg, transparent, var(--cyan), var(--violet), transparent);
  box-shadow: 0 0 28px rgba(38, 216, 255, 0.42);
}

.chart::after {
  top: 62%;
  background: linear-gradient(90deg, transparent, var(--magenta), var(--blue), transparent);
  opacity: 0.7;
}

.section-head {
  display: grid;
  grid-template-columns: minmax(0, 0.92fr) minmax(280px, 0.6fr);
  gap: 48px;
  align-items: end;
  width: min(100%, var(--showcase-width));
  margin: 0 auto 36px;
}

.muted {
  font-size: 16px;
  line-height: 1.62;
}

.story-subtitle {
  margin: 14px 0 0;
  color: var(--muted);
  font-size: clamp(26px, 3.3vw, 56px);
  font-weight: 720;
  line-height: 1.08;
}

.embedded-video-slit {
  position: relative;
  width: 100vw;
  height: clamp(220px, 18vw, 360px);
  margin: clamp(34px, 4.5vw, 64px) calc(50% - 50vw) 0;
  padding: clamp(18px, 2vw, 30px) clamp(20px, 4vw, 72px);
  overflow: hidden;
  background:
    radial-gradient(circle at 72% 18%, rgba(38, 216, 255, 0.18), transparent 32%),
    radial-gradient(circle at 18% 44%, rgba(138, 98, 255, 0.14), transparent 28%),
    linear-gradient(180deg, #061933 0%, #031025 56%, #020916 100%);
  box-shadow:
    inset 0 1px 0 rgba(157, 220, 255, 0.28),
    inset 0 28px 48px rgba(91, 176, 255, 0.08),
    inset 0 -34px 58px rgba(0, 0, 0, 0.52),
    0 18px 54px rgba(17, 45, 78, 0.16);
  isolation: isolate;
}

.embedded-video-slit::before {
  content: "";
  position: absolute;
  inset: 0 clamp(20px, 4vw, 72px) auto;
  height: 1px;
  background: linear-gradient(90deg, transparent, rgba(38, 216, 255, 0.34), rgba(138, 98, 255, 0.3), transparent);
  pointer-events: none;
}

.embedded-video-card {
  position: relative;
  z-index: 1;
  display: block;
  height: 100%;
  min-height: clamp(176px, 14vw, 260px);
  overflow: hidden;
  border: 1px solid rgba(38, 216, 255, 0.16);
  border-radius: 18px;
  background:
    linear-gradient(90deg, rgba(4, 18, 43, 0.98) 0%, rgba(4, 18, 43, 0.94) 27%, rgba(5, 20, 45, 0.68) 43%, rgba(5, 17, 38, 0.52) 100%);
  box-shadow:
    inset 0 0 0 1px rgba(86, 190, 255, 0.08),
    inset 0 18px 30px rgba(255, 255, 255, 0.05),
    inset 0 -24px 42px rgba(0, 0, 0, 0.48),
    0 20px 60px rgba(0, 62, 148, 0.18);
}

.embedded-video-card::before {
  content: "";
  position: absolute;
  inset: 0;
  z-index: 3;
  border-radius: inherit;
  box-shadow:
    inset 0 1px 0 rgba(201, 241, 255, 0.24),
    inset 0 -1px 0 rgba(3, 10, 24, 0.82),
    inset 0 0 34px rgba(38, 216, 255, 0.08);
  pointer-events: none;
}

.embedded-video-card::after {
  content: none;
}

.embedded-video-copy {
  position: relative;
  z-index: 4;
  display: flex;
  flex-direction: column;
  justify-content: center;
  padding: clamp(24px, 3vw, 44px);
  color: #f2f8ff;
}

.embedded-video-kicker {
  margin: 0 0 10px;
  color: #8edcff;
  font-size: 11px;
  font-weight: 780;
  letter-spacing: 0.08em;
  text-transform: uppercase;
}

.embedded-video-copy h3 {
  margin: 0;
  color: #ffffff;
  font-size: clamp(24px, 2.4vw, 42px);
  font-weight: 840;
  line-height: 1;
  letter-spacing: 0;
  text-transform: uppercase;
}

.embedded-video-copy p:not(.embedded-video-kicker) {
  max-width: 390px;
  margin: 16px 0 0;
  color: rgba(222, 238, 255, 0.74);
  font-size: clamp(14px, 1vw, 17px);
  line-height: 1.5;
}

.embedded-video-cta {
  align-self: flex-start;
  display: inline-flex;
  align-items: center;
  gap: 12px;
  margin-top: 24px;
  padding: 13px 22px;
  border: 1px solid rgba(255, 255, 255, 0.16);
  border-radius: 999px;
  color: #ffffff;
  background: linear-gradient(135deg, #8a62ff 0%, #1777d2 54%, #26d8ff 100%);
  box-shadow: 0 12px 28px rgba(23, 119, 210, 0.34);
  font-size: 14px;
  font-weight: 780;
  transition: transform 180ms ease, box-shadow 180ms ease;
}

.embedded-video-cta:hover {
  box-shadow: 0 16px 34px rgba(38, 216, 255, 0.28);
  transform: translateY(-1px);
}

.embedded-video-window {
  position: relative;
  z-index: 1;
  display: block;
  height: 100%;
  min-height: clamp(176px, 14vw, 260px);
  overflow: hidden;
  color: inherit;
  background: #051225;
  box-shadow:
    inset 0 0 0 1px rgba(157, 220, 255, 0.08);
}

.embedded-video-bg,
.embedded-video-main {
  position: absolute;
  inset: 0;
  display: block;
  width: 100%;
  height: 100%;
}

.embedded-video-bg {
  object-fit: cover;
  filter: blur(16px);
  opacity: 0.36;
  transform: scale(1.12);
}

.embedded-video-main {
  z-index: 1;
  object-fit: cover;
  object-position: center center;
  filter: none;
  image-rendering: auto;
  mix-blend-mode: normal;
  opacity: 1;
}

.embedded-video-window::before,
.embedded-video-window::after {
  content: "";
  position: absolute;
  inset: 0;
  z-index: 2;
  pointer-events: none;
}

.embedded-video-window::before {
  background:
    linear-gradient(90deg, rgba(4, 18, 43, 0.36), transparent 18%, transparent 82%, rgba(4, 18, 43, 0.42)),
    linear-gradient(180deg, rgba(157, 220, 255, 0.24), transparent 18%, rgba(0, 0, 0, 0.46) 100%);
}

.embedded-video-window::after {
  box-shadow:
    inset 0 1px 0 rgba(157, 220, 255, 0.35),
    inset 0 -1px 0 rgba(0, 0, 0, 0.74),
    inset 0 0 30px rgba(38, 216, 255, 0.13);
}

.embedded-video-play {
  position: absolute;
  left: 50%;
  top: 50%;
  z-index: 4;
  width: clamp(54px, 4.4vw, 78px);
  height: clamp(54px, 4.4vw, 78px);
  border: 1px solid rgba(255, 255, 255, 0.16);
  border-radius: 50%;
  background: rgba(3, 10, 24, 0.68);
  box-shadow:
    0 0 0 8px rgba(38, 216, 255, 0.06),
    0 14px 34px rgba(0, 0, 0, 0.34);
  transform: translate(-50%, -50%);
}

.embedded-video-play::before {
  content: "";
  position: absolute;
  left: 52%;
  top: 50%;
  border-top: 12px solid transparent;
  border-bottom: 12px solid transparent;
  border-left: 17px solid #ffffff;
  transform: translate(-38%, -50%);
}

.theme-white .embedded-video-slit {
  background:
    radial-gradient(circle at 72% 18%, rgba(38, 216, 255, 0.2), transparent 34%),
    radial-gradient(circle at 16% 42%, rgba(138, 98, 255, 0.12), transparent 30%),
    linear-gradient(180deg, #eaf8ff 0%, #dff2fc 52%, #d3eaf8 100%);
  box-shadow:
    inset 0 1px 0 rgba(255, 255, 255, 0.78),
    inset 0 18px 34px rgba(255, 255, 255, 0.34),
    inset 0 -22px 40px rgba(23, 119, 210, 0.1),
    0 18px 48px rgba(23, 119, 210, 0.12);
}

.theme-white .embedded-video-slit::before {
  background: linear-gradient(90deg, transparent, rgba(23, 119, 210, 0.18), rgba(38, 216, 255, 0.3), transparent);
}

.theme-white .embedded-video-card {
  border-color: rgba(23, 119, 210, 0.18);
  background:
    linear-gradient(90deg, rgba(242, 250, 255, 0.98) 0%, rgba(233, 246, 255, 0.95) 28%, rgba(223, 241, 252, 0.72) 46%, rgba(216, 237, 249, 0.58) 100%);
  box-shadow:
    inset 0 0 0 1px rgba(255, 255, 255, 0.58),
    inset 0 14px 28px rgba(255, 255, 255, 0.42),
    inset 0 -18px 34px rgba(23, 119, 210, 0.08),
    0 18px 48px rgba(23, 119, 210, 0.14);
}

.theme-white .embedded-video-card::before {
  box-shadow:
    inset 0 1px 0 rgba(255, 255, 255, 0.9),
    inset 0 -1px 0 rgba(23, 119, 210, 0.12),
    inset 0 0 30px rgba(38, 216, 255, 0.12);
}

.theme-white .embedded-video-card::after {
  content: none;
}

.theme-white .embedded-video-copy {
  color: #10213c;
}

.theme-white .embedded-video-kicker {
  color: #1777d2;
}

.theme-white .embedded-video-copy h3 {
  color: #071d38;
}

.theme-white .embedded-video-copy p:not(.embedded-video-kicker) {
  color: rgba(11, 20, 38, 0.66);
}

.theme-white .embedded-video-window {
  background: #d9effb;
  box-shadow:
    inset 0 0 0 1px rgba(23, 119, 210, 0.08);
}

.theme-white .embedded-video-bg {
  filter: blur(16px);
  opacity: 0.28;
}

.theme-white .embedded-video-main {
  filter: none;
  mix-blend-mode: normal;
  opacity: 1;
}

.theme-white .embedded-video-window::before {
  background:
    linear-gradient(90deg, rgba(242, 250, 255, 0.28), transparent 18%, transparent 82%, rgba(216, 237, 249, 0.3)),
    linear-gradient(180deg, rgba(255, 255, 255, 0.36), transparent 26%, rgba(23, 119, 210, 0.18) 100%);
}

.theme-white .embedded-video-window::after {
  box-shadow:
    inset 0 1px 0 rgba(255, 255, 255, 0.66),
    inset 0 -1px 0 rgba(23, 119, 210, 0.18),
    inset 0 0 30px rgba(38, 216, 255, 0.12);
}

.theme-white .embedded-video-play {
  border-color: rgba(255, 255, 255, 0.52);
  background: rgba(7, 29, 56, 0.58);
  box-shadow:
    0 0 0 8px rgba(38, 216, 255, 0.1),
    0 14px 34px rgba(23, 119, 210, 0.22);
}

.theme-dark .embedded-video-slit {
  box-shadow:
    inset 0 30px 42px rgba(157, 220, 255, 0.16),
    inset 0 -34px 50px rgba(0, 0, 0, 0.68),
    inset 0 0 40px rgba(0, 0, 0, 0.58),
    0 20px 60px rgba(0, 116, 255, 0.18);
}

@media (max-width: 820px) {
  .embedded-video-card {
    display: block;
  }

  .embedded-video-window {
    min-height: 220px;
  }
}

.grid-3,
.workflow,
.packages {
  display: grid;
  grid-template-columns: repeat(3, minmax(0, 1fr));
  gap: 16px;
}

.value-cards {
  display: grid;
  grid-template-columns: repeat(4, minmax(0, 1fr));
  gap: 16px;
}

.customer-strip {
  position: relative;
  display: grid;
  grid-template-columns: auto minmax(0, 1fr);
  align-items: center;
  gap: 18px;
  margin-top: 30px;
  padding: 10px 0;
  color: var(--card-text);
  overflow: hidden;
}

.customer-strip::before,
.customer-strip::after {
  content: none;
}

.customer-strip-label {
  position: relative;
  z-index: 3;
  color: var(--card-muted);
  font-size: 15px;
  font-weight: 720;
  white-space: nowrap;
}

.customer-marquee {
  min-width: 0;
  overflow: hidden;
  mask-image: linear-gradient(90deg, transparent, #000 8%, #000 92%, transparent);
}

.customer-marquee-track {
  display: flex;
  width: max-content;
  align-items: center;
  gap: clamp(20px, 2.4vw, 36px);
  animation: customerMarquee 22s linear infinite;
}

.customer-strip strong {
  color: var(--card-text);
  font-size: clamp(16px, 1.15vw, 21px);
  font-weight: 820;
  letter-spacing: 0;
  white-space: nowrap;
}

.customer-strip:hover .customer-marquee-track {
  animation-play-state: paused;
}

@keyframes customerMarquee {
  from {
    transform: translateX(0);
  }

  to {
    transform: translateX(calc(-50% - clamp(10px, 1.2vw, 18px)));
  }
}

.data-layout,
.case-study,
.video-strip {
  display: grid;
  grid-template-columns: 0.62fr 1fr;
  gap: 18px;
}

.card,
.panel,
.package,
.video-strip {
  border: 1px solid var(--line);
  border-radius: 20px;
  background: var(--surface);
  box-shadow: 0 30px 80px rgba(17, 45, 78, 0.09);
  backdrop-filter: blur(18px);
  color: var(--card-text);
}

.card,
.panel,
.package {
  padding: 24px;
}

.card p {
  margin-top: 14px;
  font-size: 15px;
  line-height: 1.56;
}

.paragraph-gap {
  margin-top: 18px;
}

.value-card {
  min-height: 250px;
}

.icon-slot {
  display: grid;
  place-items: center;
  width: 86px;
  height: 86px;
  margin-bottom: 28px;
  border: 1px solid var(--line);
  border-radius: 18px;
  background:
    radial-gradient(circle at 42% 34%, rgba(38, 216, 255, 0.24), transparent 38%),
    linear-gradient(135deg, rgba(38, 216, 255, 0.12), rgba(138, 98, 255, 0.08));
  overflow: visible;
}

.icon-slot img {
  display: block;
  width: 112%;
  height: 112%;
  object-fit: contain;
  filter: drop-shadow(0 12px 22px rgba(23, 119, 210, 0.2));
}

.theme-dark .card p,
.theme-dark .muted,
.theme-dark .package-list,
.theme-dark .data-pill {
  color: var(--card-muted);
}

.workflow .card {
  min-height: 250px;
}

.placeholder-panel {
  min-height: 138px;
  margin: 24px 0 18px;
  border: 1px solid var(--line);
  border-radius: 16px;
  background:
    linear-gradient(var(--grid) 1px, transparent 1px),
    linear-gradient(90deg, var(--grid) 1px, transparent 1px),
    rgba(255, 255, 255, 0.04);
  background-size: 28px 28px;
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.08);
}

.large-panel {
  min-height: 360px;
  margin: 0;
}

.data-showcase {
  grid-template-columns: minmax(0, 0.74fr) minmax(0, 1.16fr);
  align-items: start;
  gap: 26px;
}

.data-card {
  min-width: 0;
}

.data-visual {
  position: relative;
  min-height: clamp(260px, 25vw, 410px);
  overflow: hidden;
  border: 1px solid var(--line);
  border-radius: 16px;
  background:
    linear-gradient(var(--grid) 1px, transparent 1px),
    linear-gradient(90deg, var(--grid) 1px, transparent 1px),
    rgba(255, 255, 255, 0.18);
  background-size: 28px 28px;
  box-shadow: 0 26px 70px rgba(18, 84, 140, 0.08);
}

.data-index {
  margin: 22px 0 14px;
  color: var(--muted);
  font-size: 16px;
  font-weight: 650;
}

.data-card h3 {
  max-width: 560px;
  margin: 0;
  color: var(--text);
  font-size: clamp(24px, 2.2vw, 34px);
  line-height: 1.15;
}

.quality-visual {
  background:
    linear-gradient(90deg, rgba(75, 219, 134, 0.18) 0 28%, rgba(255, 221, 103, 0.2) 28% 48%, rgba(98, 204, 226, 0.16) 48% 100%),
    linear-gradient(var(--grid) 1px, transparent 1px),
    linear-gradient(90deg, var(--grid) 1px, transparent 1px),
    rgba(255, 255, 255, 0.5);
  background-size: auto, 36px 36px, 36px 36px, auto;
}

.stage-band {
  position: absolute;
  top: 18px;
  color: rgba(20, 86, 120, 0.52);
  font-size: 13px;
  font-weight: 850;
}

.stage-one { left: 14%; }
.stage-two { left: 35%; }
.stage-three { right: 18%; }

.quality-axis {
  position: absolute;
  left: 34px;
  right: 24px;
  top: 38px;
  bottom: 44px;
  border-left: 2px solid rgba(42, 62, 82, 0.28);
  border-bottom: 2px solid rgba(42, 62, 82, 0.28);
}

.quality-target {
  position: absolute;
  left: 34px;
  right: 24px;
  bottom: 70px;
  border-top: 2px dashed rgba(243, 168, 55, 0.55);
}

.quality-series i {
  position: absolute;
  left: calc(34px + (100% - 58px) * var(--x));
  top: calc(38px + (100% - 82px) * var(--y));
  width: 9px;
  height: 9px;
  border-radius: 999px;
  transform: translate(-50%, -50%);
  box-shadow: 0 0 0 4px rgba(255, 255, 255, 0.42);
}

.quality-series i::before,
.quality-series i::after {
  content: "";
  position: absolute;
  left: 50%;
  width: 2px;
  height: 16px;
  background: currentColor;
  transform: translateX(-50%);
  opacity: 0.55;
}

.quality-series i::before { bottom: 8px; }
.quality-series i::after { top: 8px; }

.quality-series.red i { color: #dc3d31; background: #dc3d31; }
.quality-series.green i { color: #41b66c; background: #41b66c; }
.quality-series.purple i { color: #9e55d7; background: #9e55d7; }

.compare-visual {
  min-height: clamp(260px, 25vw, 410px);
  padding: 28px 20px 24px;
  background: rgba(255, 255, 255, 0.88);
}

.compare-topbar {
  position: absolute;
  left: 18px;
  right: 18px;
  top: 14px;
  height: 10px;
  border-radius: 999px 999px 0 0;
  background: linear-gradient(90deg, #0c0b2a, #101538);
}

.compare-panel {
  position: absolute;
  display: grid;
  align-content: start;
  gap: 7px;
  padding: 12px;
  border: 1px solid rgba(20, 28, 48, 0.08);
  border-radius: 8px;
  background: rgba(255, 255, 255, 0.74);
  color: #172033;
  font-size: 11px;
}

.compare-panel strong {
  font-size: 12px;
}

.compare-panel span {
  min-height: 14px;
  padding-left: 18px;
  background:
    linear-gradient(90deg, #1ec8a5, #ff7b6e) 0 50% / 11px 5px no-repeat;
}

.select-list {
  left: 20px;
  top: 36px;
  width: 22%;
  height: 44%;
}

.feature-list {
  left: 26%;
  top: 36px;
  width: 22%;
  height: 44%;
}

.meta-list {
  right: 20px;
  top: 36px;
  width: 22%;
  height: 44%;
}

.compare-radar {
  position: absolute;
  left: 51%;
  top: 38px;
  width: 22%;
  height: 43%;
  background:
    radial-gradient(circle at 50% 50%, rgba(39, 131, 245, 0.15) 0 35%, transparent 36%),
    repeating-radial-gradient(circle at 50% 50%, transparent 0 21px, rgba(23, 52, 88, 0.16) 22px 23px);
}

.compare-radar::before {
  content: "";
  position: absolute;
  inset: 25% 18% 18% 15%;
  clip-path: polygon(50% 0, 88% 28%, 75% 82%, 25% 78%, 8% 32%);
  background: rgba(28, 119, 240, 0.5);
  border: 2px solid rgba(28, 119, 240, 0.8);
}

.compare-radar span {
  position: absolute;
  left: 52%;
  top: 44%;
  width: 9px;
  height: 9px;
  border-radius: 999px;
  background: #ff713e;
  box-shadow: 26px 6px 0 #19b984, -18px 16px 0 #1a77ef;
}

.sequence-strip {
  position: absolute;
  left: 20px;
  right: 20px;
  height: 42px;
  border-radius: 4px;
  background:
    repeating-linear-gradient(90deg, #ffe27d 0 8px, #80df9a 8px 16px, #9ad7ff 16px 24px, #f6a0b0 24px 32px);
  opacity: 0.82;
}

.strip-a { bottom: 76px; }
.strip-b { bottom: 28px; }

.compare-gradient {
  position: absolute;
  left: 20px;
  right: 20px;
  bottom: 14px;
  height: 7px;
  border-radius: 999px;
  background: linear-gradient(90deg, #0ec6a7, #4379ff, #e84d8e, #a76a2b);
}

.theme-dark .data-visual {
  background-color: rgba(8, 22, 42, 0.56);
}

.theme-dark .compare-visual {
  background: rgba(236, 244, 252, 0.92);
}

.single-data-showcase {
  display: block;
  width: min(100%, var(--showcase-width));
  margin-inline: auto;
}

.data-screenshot-showcase {
  display: block;
  width: min(100%, var(--showcase-width));
  margin-inline: auto;
  padding: clamp(6px, 0.8vw, 10px);
  border: 1px solid var(--line);
  border-radius: 22px;
  background: rgba(255, 255, 255, 0.62);
  box-shadow: 0 34px 92px rgba(17, 45, 78, 0.12);
}

.theme-dark .data-screenshot-showcase {
  background:
    linear-gradient(180deg, rgba(238, 247, 255, 0.08), rgba(14, 28, 50, 0.1)),
    rgba(8, 18, 35, 0.54);
  box-shadow: 0 34px 96px rgba(0, 8, 18, 0.32);
}

.data-dashboard-shot {
  display: block;
  width: 100%;
  height: auto;
  border-radius: 16px;
}

.report-frame-shell {
  --report-width: 1280px;
  --report-height: 574px;
  container-type: inline-size;
  position: relative;
  width: min(100%, var(--showcase-width));
  aspect-ratio: 1280 / 574;
  margin-inline: auto;
  overflow: hidden;
  border: 1px solid var(--line);
  border-radius: 22px;
  background: rgba(247, 251, 253, 0.95);
  box-shadow: 0 34px 92px rgba(17, 45, 78, 0.12);
}

.theme-dark .report-frame-shell {
  background: rgba(247, 251, 253, 0.96);
  box-shadow: 0 34px 96px rgba(0, 8, 18, 0.32);
}

.report-frame-case {
  --report-height: 930px;
  aspect-ratio: 1280 / 930;
}

.report-embed-frame {
  display: block;
  width: var(--report-width);
  height: var(--report-height);
  border: 0;
  background: transparent;
  transform: scale(calc(100cqw / 1280px));
  transform-origin: top left;
}

.compare-visual-large {
  min-height: clamp(460px, 38vw, 640px);
  border-radius: 22px;
  background:
    linear-gradient(180deg, rgba(255, 255, 255, 0.96), rgba(248, 252, 255, 0.92)),
    linear-gradient(var(--grid) 1px, transparent 1px),
    linear-gradient(90deg, var(--grid) 1px, transparent 1px);
  background-size: auto, 28px 28px, 28px 28px;
  box-shadow: 0 30px 90px rgba(17, 45, 78, 0.11);
}

.compare-visual-large .compare-topbar {
  height: 14px;
  left: 28px;
  right: 28px;
  top: 22px;
}

.compare-title {
  position: absolute;
  left: 32px;
  top: 54px;
  margin: 0;
  color: #101525;
  font-size: clamp(20px, 1.7vw, 28px);
}

.compare-visual-large .compare-panel {
  padding: 18px;
  border-radius: 12px;
  font-size: clamp(12px, 0.9vw, 15px);
}

.compare-visual-large .compare-panel strong {
  font-size: clamp(14px, 1vw, 17px);
}

.compare-visual-large .select-list {
  left: 32px;
  top: 96px;
  width: 24%;
  height: 40%;
}

.compare-visual-large .feature-list {
  left: 29%;
  top: 96px;
  width: 24%;
  height: 40%;
}

.compare-visual-large .meta-list {
  right: 32px;
  top: 96px;
  width: 22%;
  height: 40%;
}

.compare-visual-large .compare-panel span {
  position: relative;
  min-height: 22px;
  padding-left: 24px;
  animation: featureBlink 4.8s ease-in-out infinite;
}

.compare-visual-large .feature-list span {
  background:
    linear-gradient(#101525, #101525) 0 50% / 15px 15px no-repeat;
}

.compare-visual-large .feature-list span::after {
  content: "";
  position: absolute;
  left: 4px;
  top: 7px;
  width: 8px;
  height: 4px;
  border-left: 2px solid #ffffff;
  border-bottom: 2px solid #ffffff;
  transform: rotate(-45deg);
}

.compare-visual-large .compare-radar {
  left: 55%;
  top: 96px;
  width: 18%;
  height: 40%;
  animation: orbitBreath 4.8s ease-in-out infinite;
}

.compare-visual-large .compare-radar::before {
  animation: radarMorph 5.4s ease-in-out infinite;
}

.compare-visual-large .compare-radar span {
  animation: metricGlow 4.8s ease-in-out infinite;
}

.feature-cursor {
  position: absolute;
  left: 42px;
  top: 96px;
  width: 34px;
  height: 42px;
  background: url("data:image/svg+xml,%3Csvg width='44' height='54' viewBox='0 0 44 54' xmlns='http://www.w3.org/2000/svg'%3E%3Cpath d='M5 3l25 23-13 2 9 17-7 4-9-17-9 10z' fill='%23fff' stroke='%2310182d' stroke-width='4'/%3E%3C/svg%3E") center / contain no-repeat;
  filter: drop-shadow(0 8px 8px rgba(0, 0, 0, 0.18));
  animation: cursorSelect 5.2s ease-in-out infinite;
}

.compare-visual-large .sequence-strip {
  left: 32px;
  right: 32px;
  height: clamp(70px, 5vw, 86px);
  padding: 18px 12px 10px;
  overflow: visible;
  border: 1px solid rgba(26, 196, 202, 0.28);
  border-radius: 4px;
  background:
    repeating-linear-gradient(90deg, rgba(255, 255, 255, 0.18) 0 1px, transparent 1px 12px),
    repeating-linear-gradient(180deg, #18c4ca 0 13px, #0f9fb8 13px 16px);
  box-shadow:
    inset 0 0 0 1px rgba(255, 255, 255, 0.18),
    0 10px 28px rgba(26, 196, 202, 0.12);
  animation: sequenceHeatmap 8s linear infinite;
}

.compare-visual-large .sequence-strip span {
  position: absolute;
  left: 0;
  top: -20px;
  color: #243044;
  font-size: 12px;
  font-weight: 850;
}

.compare-visual-large .sequence-strip::before {
  content: ".          .          .          .          .          .          .          .          .";
  position: absolute;
  left: 12px;
  right: 12px;
  top: 0;
  color: #111827;
  font-family: Consolas, "Courier New", monospace;
  font-size: clamp(8px, 0.62vw, 11px);
  font-weight: 850;
  letter-spacing: 0.24em;
  white-space: nowrap;
  overflow: hidden;
}

.compare-visual-large .sequence-strip::after {
  content: "CATTGGGCGAAAGCGGGCTATATCTGCACGGCACGCCGTACAAACTGGCACCGGATCAGCAGACGCATATTCGATGCAG\A CATTGGGCGAAAGCGGGCTATATCTGCACGGCACGCCGTACAAACTGGCACCGGATCAGCAGACGCATATTCGATGCAG\A CATTGGGCGAAAGCGGGCTATATCTGCACGGCACGCCGTACAAACTGGCACCGGATCAGCAGACGCATATTCGATGCAG\A CATTGGGCGAAAGCGGGCTATATCTGCACGGCACGCCGTACAAACTGGCACCGGATCAGCAGACGCATATTCGATGCAG";
  position: relative;
  z-index: 1;
  display: block;
  color: #ffffff;
  font-family: Consolas, "Courier New", monospace;
  font-size: clamp(7px, 0.58vw, 10px);
  font-weight: 900;
  line-height: 1.22;
  white-space: pre;
  letter-spacing: 0.06em;
  text-shadow: 0 1px 0 rgba(0, 65, 82, 0.34);
  overflow: hidden;
}

.compare-visual-large .strip-a {
  bottom: 106px;
}

.compare-visual-large .strip-b {
  bottom: 34px;
  animation-delay: -2.4s;
}

.compare-visual-large .compare-gradient {
  left: 32px;
  right: 32px;
  bottom: 18px;
  height: 9px;
}

@keyframes cursorSelect {
  0%, 100% { transform: translate(0, 0) scale(1); opacity: 0.9; }
  38% { transform: translate(8px, 54px) scale(1.05); opacity: 1; }
  58% { transform: translate(8px, 54px) scale(0.92); opacity: 1; }
  78% { transform: translate(14px, 106px) scale(1); opacity: 0.92; }
}

@keyframes featureBlink {
  0%, 100% { opacity: 0.68; }
  44%, 62% { opacity: 1; }
}

@keyframes radarMorph {
  0%, 100% { clip-path: polygon(50% 0, 88% 28%, 75% 82%, 25% 78%, 8% 32%); }
  50% { clip-path: polygon(50% 8%, 78% 22%, 86% 72%, 31% 88%, 14% 44%); }
}

@keyframes sequenceHeatmap {
  from { background-position: 0 0; }
  to { background-position: 220px 0; }
}

.data-loop-panel {
  margin-top: 18px;
  padding: 24px;
}

.step-number {
  display: inline-flex;
  align-items: center;
  justify-content: center;
  width: 30px;
  height: 30px;
  margin-bottom: 46px;
  border-radius: 999px;
  background: rgba(38, 216, 255, 0.11);
  color: color-mix(in srgb, var(--blue), var(--ink) 14%);
  font-size: 12px;
  font-weight: 800;
}

.data-list {
  display: grid;
  gap: 10px;
}

.data-pill {
  display: flex;
  justify-content: space-between;
  gap: 20px;
  padding: 13px 15px;
  border: 1px solid var(--line);
  border-radius: 12px;
  color: var(--muted);
  font-size: 13px;
}

.dashboard-grid {
  display: grid;
  grid-template-columns: repeat(2, minmax(0, 1fr));
  gap: 12px;
}

.workflow-section .section-head {
  margin-bottom: 24px;
}

.rush-flow-board {
  position: relative;
  display: grid;
  grid-template-columns: minmax(240px, 0.92fr) 54px minmax(280px, 1fr) 54px minmax(270px, 0.96fr);
  gap: 0;
  align-items: center;
  min-height: clamp(470px, 35vw, 570px);
  padding: clamp(18px, 2.2vw, 34px) clamp(16px, 2.4vw, 34px) clamp(62px, 5.4vw, 88px);
  overflow: hidden;
  border: 1px solid rgba(76, 178, 255, 0.24);
  border-radius: 8px;
  background:
    radial-gradient(circle at 50% 40%, rgba(255, 255, 255, 0.72), transparent 30%),
    linear-gradient(90deg, rgba(236, 248, 255, 0.82), rgba(222, 242, 255, 0.6)),
    var(--grid);
  box-shadow: 0 28px 90px rgba(61, 165, 216, 0.16);
}

.flow-card {
  position: relative;
  z-index: 2;
  display: grid;
  grid-template-rows: 58px minmax(0, 1fr) 52px;
  align-self: start;
  height: clamp(382px, 29vw, 430px);
  min-height: 0;
  color: #07305f;
}

.flow-step {
  display: flex;
  align-items: flex-start;
  gap: 12px;
  min-height: 54px;
  color: #0b43d4;
  font-size: clamp(14px, 1.05vw, 18px);
  font-weight: 900;
  line-height: 1.08;
}

.flow-step span {
  display: inline-flex;
  flex: 0 0 auto;
  align-items: center;
  justify-content: center;
  width: 28px;
  height: 28px;
  border-radius: 999px;
  color: white;
  background: linear-gradient(135deg, #155df6, #06a8ff);
  box-shadow: 0 8px 18px rgba(22, 93, 246, 0.28);
}

.flow-card p {
  align-self: start;
  display: flex;
  align-items: flex-start;
  justify-content: center;
  max-width: 310px;
  min-height: 42px;
  margin: 8px auto 0;
  color: #0b43d4;
  font-size: clamp(11px, 0.82vw, 14px);
  font-weight: 800;
  line-height: 1.28;
  text-align: center;
}

.dashboard-flow-card p {
  margin-top: 26px;
}

.sequence-window {
  position: relative;
  align-self: center;
  width: min(330px, 100%);
  height: 240px;
  margin: 8px auto 0;
  overflow: hidden;
  border: 1px solid rgba(87, 158, 255, 0.3);
  border-radius: 8px;
  background:
    linear-gradient(180deg, rgba(255, 255, 255, 0.82), rgba(255, 255, 255, 0.38)),
    linear-gradient(90deg, rgba(53, 129, 255, 0.14), transparent);
  box-shadow: 0 20px 60px rgba(59, 134, 255, 0.14);
}

.sequence-chip {
  position: absolute;
  left: 0;
  top: 18px;
  z-index: 3;
  min-width: 174px;
  padding: 10px 18px;
  border-radius: 0 999px 999px 0;
  color: #ffffff;
  background: linear-gradient(135deg, #1664f6, #57b7ff);
  box-shadow: 0 14px 28px rgba(22, 100, 246, 0.26);
  font-size: 11px;
  font-weight: 900;
}

.sequence-window::before,
.sequence-window::after {
  content: "";
  position: absolute;
  left: 50%;
  z-index: 1;
  width: 12px;
  height: 66px;
  border-radius: 999px;
  background: linear-gradient(180deg, transparent, rgba(43, 130, 255, 0.82), transparent);
  transform: translateX(-50%);
  animation: floatArrow 2.8s ease-in-out infinite;
}

.sequence-window::before { top: -6px; }
.sequence-window::after { right: 18%; left: auto; top: 18px; animation-delay: 0.7s; }

.sequence-stream {
  display: grid;
  gap: 10px;
  padding: 64px 18px 18px;
  animation: sequenceFloatLong 16s linear infinite;
}

.sequence-row {
  display: grid;
  grid-template-columns: 28px minmax(0, 1fr);
  gap: 10px;
  align-items: center;
  min-height: 50px;
  padding: 9px 10px;
  border-radius: 8px;
  background: rgba(255, 255, 255, 0.78);
  box-shadow: 0 12px 30px rgba(70, 133, 220, 0.12);
}

.sequence-row b {
  width: 20px;
  height: 20px;
  background: url("data:image/svg+xml,%3Csvg width='42' height='42' viewBox='0 0 42 42' xmlns='http://www.w3.org/2000/svg'%3E%3Cg fill='none' stroke='%231f77ff' stroke-width='4' stroke-linecap='round'%3E%3Cpath d='M21 20v15M21 20L9 9M21 20l12-11M13 13h-7M29 13h7'/%3E%3C/g%3E%3C/svg%3E") center / contain no-repeat;
}

.sequence-row span {
  display: -webkit-box;
  overflow: hidden;
  color: #286ef0;
  font-size: 8px;
  font-weight: 800;
  line-height: 1.22;
  overflow-wrap: anywhere;
  -webkit-line-clamp: 2;
  -webkit-box-orient: vertical;
}

.flow-connector {
  position: relative;
  z-index: 1;
  align-self: center;
  height: 126px;
  margin-top: 58px;
}

.flow-connector span {
  position: absolute;
  left: -12px;
  right: -12px;
  top: 50%;
  height: 42px;
  border-radius: 999px;
  background:
    repeating-linear-gradient(90deg, transparent 0 18px, rgba(255, 255, 255, 0.78) 19px 21px, transparent 22px 36px),
    linear-gradient(90deg, rgba(67, 150, 255, 0.08), rgba(67, 150, 255, 0.42), rgba(67, 150, 255, 0.08));
  filter: blur(0.2px);
  transform: translateY(-50%);
  animation: dataPulse 2.8s linear infinite;
}

.flow-connector i {
  position: absolute;
  right: -8px;
  top: 50%;
  width: 0;
  height: 0;
  border-top: 16px solid transparent;
  border-bottom: 16px solid transparent;
  border-left: 22px solid #2788ff;
  filter: drop-shadow(0 0 16px rgba(39, 136, 255, 0.42));
  transform: translateY(-50%);
}

.assay-visual {
  display: grid;
  align-self: center;
  place-items: center;
  min-height: 0;
}

.orbit-ring {
  position: relative;
  width: min(260px, 88%);
  aspect-ratio: 1;
  border: 3px solid rgba(82, 150, 255, 0.18);
  border-radius: 999px;
  background:
    radial-gradient(circle at center, rgba(255, 255, 255, 0.86) 0 25%, transparent 26%),
    conic-gradient(from 0deg, rgba(66, 140, 255, 0.1), rgba(66, 140, 255, 0.44), rgba(66, 140, 255, 0.1));
  box-shadow: inset 0 0 28px rgba(73, 158, 255, 0.12);
}

.orbit-ring::after {
  content: "";
  position: absolute;
  inset: 18px;
  border: 2px dashed rgba(55, 139, 255, 0.34);
  border-radius: inherit;
  animation: orbitSpin 10s linear infinite;
}

.workflow-antibody {
  position: absolute;
  left: 50%;
  top: 50%;
  width: 86px;
  height: 124px;
  background: url("data:image/svg+xml,%3Csvg width='118' height='170' viewBox='0 0 118 170' xmlns='http://www.w3.org/2000/svg'%3E%3Cdefs%3E%3ClinearGradient id='g' x1='0' y1='0' x2='1' y2='1'%3E%3Cstop offset='0' stop-color='%230b55d8'/%3E%3Cstop offset='.28' stop-color='%234ebcff'/%3E%3Cstop offset='.48' stop-color='%23d9f0ff'/%3E%3Cstop offset='.68' stop-color='%231079e8'/%3E%3Cstop offset='1' stop-color='%231c2aa4'/%3E%3C/linearGradient%3E%3ClinearGradient id='h' x1='0' y1='0' x2='1' y2='1'%3E%3Cstop offset='0' stop-color='%232b8cff'/%3E%3Cstop offset='1' stop-color='%230e2ea7'/%3E%3C/linearGradient%3E%3Cfilter id='s' x='-30%25' y='-30%25' width='160%25' height='160%25'%3E%3CfeDropShadow dx='0' dy='12' stdDeviation='8' flood-color='%230f63d6' flood-opacity='.35'/%3E%3C/filter%3E%3C/defs%3E%3Cg stroke-linecap='round' stroke-linejoin='round' filter='url(%23s)'%3E%3Cpath d='M59 56v96' stroke='%23d7edff' stroke-width='24'/%3E%3Cpath d='M59 56v96' stroke='url(%23g)' stroke-width='16'/%3E%3Cpath d='M59 56L27 20' stroke='%23d7edff' stroke-width='24'/%3E%3Cpath d='M59 56L27 20' stroke='url(%23g)' stroke-width='16'/%3E%3Cpath d='M59 56l32-36' stroke='%23d7edff' stroke-width='24'/%3E%3Cpath d='M59 56l32-36' stroke='url(%23g)' stroke-width='16'/%3E%3Cpath d='M29 20L12 5' stroke='url(%23h)' stroke-width='16'/%3E%3Cpath d='M89 20l17-15' stroke='url(%23h)' stroke-width='16'/%3E%3Cpath d='M59 126v28' stroke='url(%23h)' stroke-width='16'/%3E%3Cpath d='M39 63h40' stroke='%23ff9b57' stroke-width='4' opacity='.9'/%3E%3C/g%3E%3C/svg%3E") center / contain no-repeat;
  transform: translate(-50%, -50%);
  filter: drop-shadow(0 16px 22px rgba(24, 96, 215, 0.28));
  animation: antibodyFloat 4s ease-in-out infinite;
}

.workflow-antibody i {
  display: none;
}

.orbit-label {
  position: absolute;
  z-index: 2;
  display: inline-flex;
  align-items: center;
  justify-content: center;
  min-width: 44px;
  min-height: 28px;
  padding: 5px 9px;
  border-radius: 999px;
  background: rgba(255, 255, 255, 0.86);
  color: #0864ff;
  font-size: 12px;
  font-weight: 900;
  box-shadow: 0 8px 24px rgba(56, 123, 240, 0.14);
}

.orbit-label.kd { left: 50%; top: -8px; transform: translateX(-50%); }
.orbit-label.ka { left: 0; top: 32%; }
.orbit-label.koff { right: 0; top: 32%; }
.orbit-label.dsf { right: 8%; top: 10%; }
.orbit-label.ac { left: 5%; bottom: 18%; }
.orbit-label.psr { right: 9%; bottom: 18%; }

.live-dashboard {
  align-self: center;
  width: min(340px, 100%);
  margin: 8px auto 0;
  padding: 10px;
  border-radius: 10px;
  background: linear-gradient(145deg, #07182c, #082648);
  box-shadow: 0 22px 58px rgba(5, 33, 69, 0.28);
  color: #e9f7ff;
  transform: perspective(900px) rotateY(-4deg);
}

.dash-header {
  display: flex;
  justify-content: space-between;
  gap: 16px;
  margin-bottom: 9px;
  font-size: 12px;
}

.dash-header span {
  position: relative;
  padding-left: 14px;
  color: #8ef7cd;
  font-weight: 800;
}

.dash-header span::before {
  content: "";
  position: absolute;
  left: 0;
  top: 50%;
  width: 8px;
  height: 8px;
  border-radius: 999px;
  background: #00e582;
  transform: translateY(-50%);
  animation: liveBlink 1.4s ease-in-out infinite;
}

.dash-grid {
  display: grid;
  grid-template-columns: repeat(3, minmax(0, 1fr));
  gap: 6px;
}

.dash-tile {
  min-height: 52px;
  padding: 7px;
  overflow: hidden;
  border: 1px solid rgba(55, 150, 255, 0.16);
  border-radius: 8px;
  background: linear-gradient(180deg, rgba(13, 61, 111, 0.92), rgba(8, 37, 75, 0.92));
}

.dash-tile small {
  display: block;
  color: #a8c7e8;
  font-size: 7px;
  font-weight: 800;
}

.dash-tile b {
  display: block;
  margin-top: 5px;
  color: #eefaff;
  font-size: 9px;
}

.dash-tile.wide {
  grid-column: span 2;
}

.latest-results {
  display: grid;
  align-content: start;
}

.sparkline,
.mini-bars,
.donut {
  display: block;
  height: 21px;
  margin-top: 5px;
}

.sparkline {
  border-bottom: 1px solid rgba(126, 198, 255, 0.35);
  background:
    radial-gradient(circle at 12% 74%, #38d7ff 0 2px, transparent 3px),
    radial-gradient(circle at 34% 42%, #38d7ff 0 2px, transparent 3px),
    radial-gradient(circle at 58% 50%, #38d7ff 0 2px, transparent 3px),
    radial-gradient(circle at 82% 18%, #38d7ff 0 2px, transparent 3px),
    linear-gradient(145deg, transparent 0 27%, #2bc8ff 28% 31%, transparent 32% 100%);
  animation: chartRefresh 2.8s ease-in-out infinite;
}

.line-b { animation-delay: 0.3s; }
.line-c { animation-delay: 0.6s; }
.line-d { animation-delay: 0.9s; }

.mini-bars {
  background:
    linear-gradient(180deg, transparent 32%, #2e8eff 33%) 8% 0 / 16% 100% no-repeat,
    linear-gradient(180deg, transparent 14%, #37d7ff 15%) 34% 0 / 16% 100% no-repeat,
    linear-gradient(180deg, transparent 44%, #2e8eff 45%) 60% 0 / 16% 100% no-repeat,
    linear-gradient(180deg, transparent 5%, #37d7ff 6%) 86% 0 / 16% 100% no-repeat;
  animation: chartRefresh 2.6s ease-in-out infinite;
}

.donut {
  width: 26px;
  margin-inline: auto;
  border-radius: 999px;
  background: conic-gradient(#2f8fff 0 72%, #1b3f72 72% 100%);
  box-shadow: inset 0 0 0 7px #082648;
}

.model-loop {
  position: absolute;
  left: 11%;
  right: 13%;
  bottom: 18px;
  z-index: 3;
  display: grid;
  grid-template-columns: 42px auto;
  grid-template-rows: auto auto;
  column-gap: 14px;
  align-items: center;
  width: min(390px, 50%);
  margin-inline: auto;
  padding: 11px 18px;
  border-radius: 18px;
  background: rgba(255, 255, 255, 0.86);
  color: #0b43d4;
  box-shadow: 0 18px 36px rgba(42, 122, 255, 0.15);
}

.model-loop::before,
.model-loop::after {
  content: "";
  position: absolute;
  bottom: 50%;
  width: 38vw;
  height: 8px;
  border-radius: 999px;
  background: linear-gradient(90deg, transparent, rgba(28, 128, 255, 0.78), transparent);
  box-shadow: 0 0 18px rgba(28, 128, 255, 0.36);
  animation: dataPulse 2.8s linear infinite;
}

.model-loop::before {
  right: 100%;
}

.model-loop::after {
  left: 100%;
}

.model-loop span {
  grid-row: 1 / 3;
  width: 34px;
  height: 34px;
  border-radius: 10px;
  background:
    linear-gradient(#1d6fff, #1d6fff) 9px 7px / 16px 5px no-repeat,
    linear-gradient(#1d6fff, #1d6fff) 6px 15px / 22px 5px no-repeat,
    linear-gradient(#1d6fff, #1d6fff) 9px 23px / 16px 5px no-repeat;
}

.model-loop strong {
  font-size: 14px;
}

.model-loop em {
  color: #1e5fe5;
  font-size: 10px;
  font-style: normal;
  font-weight: 700;
}

.theme-dark .rush-flow-board {
  background:
    radial-gradient(circle at 50% 40%, rgba(14, 50, 88, 0.7), transparent 30%),
    linear-gradient(90deg, rgba(5, 20, 42, 0.92), rgba(8, 31, 58, 0.76)),
    var(--grid);
}

.theme-dark .flow-card,
.theme-dark .flow-card p,
.theme-dark .flow-step,
.theme-dark .model-loop {
  color: #d8ebff;
}

.theme-dark .sequence-window,
.theme-dark .sequence-row,
.theme-dark .orbit-label,
.theme-dark .model-loop {
  background-color: rgba(8, 28, 52, 0.86);
}

.theme-dark .sequence-row span {
  color: #8bc5ff;
}

@keyframes sequenceFloat {
  0% { transform: translateY(34px); }
  100% { transform: translateY(-82px); }
}

@keyframes sequenceFloatLong {
  0% { transform: translateY(16px); }
  100% { transform: translateY(-250px); }
}

@keyframes floatArrow {
  0%, 100% { opacity: 0.25; transform: translate(-50%, 12px); }
  50% { opacity: 0.9; transform: translate(-50%, -10px); }
}

@keyframes dataPulse {
  0% { background-position: 0 0; opacity: 0.52; }
  50% { opacity: 1; }
  100% { background-position: 90px 0; opacity: 0.52; }
}

@keyframes orbitSpin {
  to { transform: rotate(360deg); }
}

@keyframes antibodyFloat {
  0%, 100% { transform: translate(-50%, -50%) rotate(-3deg) scale(1); }
  50% { transform: translate(-50%, -54%) rotate(3deg) scale(1.04); }
}

@keyframes chartRefresh {
  0%, 100% { opacity: 0.75; transform: translateY(0); }
  50% { opacity: 1; transform: translateY(-3px); }
}

@keyframes liveBlink {
  0%, 100% { opacity: 0.4; box-shadow: 0 0 0 0 rgba(0, 229, 130, 0.4); }
  50% { opacity: 1; box-shadow: 0 0 0 7px rgba(0, 229, 130, 0); }
}

@media (max-width: 1180px) {
  .rush-flow-board {
    grid-template-columns: 1fr;
    gap: 22px;
    padding-bottom: 34px;
  }

  .flow-card {
    min-height: auto;
  }

  .flow-connector {
    width: 72px;
    height: 72px;
    margin: -6px auto;
    transform: rotate(90deg);
  }

  .sequence-window,
  .live-dashboard {
    width: min(520px, 100%);
  }

  .model-loop {
    position: relative;
    left: auto;
    right: auto;
    bottom: auto;
    grid-column: 1;
    width: min(560px, 100%);
    margin-top: 4px;
  }

  .model-loop::before,
  .model-loop::after {
    display: none;
  }
}

@media (max-width: 680px) {
  .workflow-section .section-head {
    margin-bottom: 18px;
  }

  .rush-flow-board {
    padding: 18px;
  }

  .flow-step {
    font-size: 16px;
  }

  .sequence-window {
    height: 260px;
  }

  .assay-visual {
    min-height: 280px;
  }

  .orbit-ring {
    width: min(280px, 100%);
  }

  .workflow-antibody {
    width: 92px;
    height: 134px;
  }

  .orbit-label {
    min-width: 46px;
    min-height: 28px;
    padding: 5px 8px;
    font-size: 12px;
  }

  .dash-grid {
    grid-template-columns: repeat(2, minmax(0, 1fr));
  }
}

.dash-card {
  min-height: 118px;
}

.package {
  min-height: 350px;
}

.package h3 {
  margin-bottom: 18px;
}

.package-list {
  display: grid;
  gap: 12px;
  margin-top: 26px;
  font-size: 14px;
}

.package-list span {
  display: block;
  padding-top: 12px;
  border-top: 1px solid var(--line);
}

.package-offers {
  display: grid;
  grid-template-columns: minmax(0, 1fr) minmax(0, 1.2fr) minmax(0, 1fr);
  width: min(100%, var(--showcase-width));
  margin-inline: auto;
  overflow: hidden;
  border: 1px solid var(--line);
  border-radius: 22px;
  background: rgba(255, 255, 255, 0.82);
  box-shadow: 0 30px 80px rgba(17, 45, 78, 0.09);
  backdrop-filter: blur(18px);
}

.offer-card {
  position: relative;
  display: grid;
  grid-template-rows: auto auto minmax(92px, auto) auto 1fr;
  align-content: start;
  min-height: 500px;
  padding: clamp(26px, 2.5vw, 42px);
  color: #151923;
  background: rgba(255, 255, 255, 0.72);
  border-right: 1px solid rgba(170, 183, 210, 0.34);
}

.offer-card:last-child {
  border-right: 0;
}

.offer-card.featured,
.offer-card.premium {
  background:
    radial-gradient(circle at 78% 10%, rgba(120, 99, 255, 0.14), transparent 34%),
    linear-gradient(180deg, rgba(242, 242, 255, 0.92), rgba(255, 255, 255, 0.72));
}

.offer-card h3 {
  margin: 0 0 28px;
  font-size: clamp(28px, 2.6vw, 42px);
  font-weight: 720;
  letter-spacing: 0;
}

.offer-badge {
  position: absolute;
  right: 26px;
  top: 28px;
  padding: 8px 14px;
  border-radius: 999px;
  color: #6254e9;
  background: rgba(117, 97, 255, 0.13);
  font-size: 12px;
  font-weight: 850;
  text-transform: uppercase;
}

.offer-price {
  display: grid;
  gap: 3px;
  min-height: 96px;
  margin-bottom: 0;
  align-content: start;
}

.offer-price span {
  color: #7a8291;
  font-size: 18px;
  font-weight: 650;
}

.offer-price strong {
  color: #111827;
  font-size: clamp(32px, 3vw, 50px);
  line-height: 0.98;
  overflow-wrap: normal;
  word-break: keep-all;
  hyphens: none;
}

.offer-card p {
  min-height: 92px;
  margin: 0;
  color: #454b57;
  font-size: 17px;
  line-height: 1.4;
}

.offer-button {
  display: grid;
  place-items: center;
  min-height: 54px;
  margin: 0 0 28px;
  border-radius: 999px;
  color: #ffffff;
  background: linear-gradient(90deg, #238ec6, #36bfd1);
  font-size: 16px;
  font-weight: 800;
  cursor: default;
  pointer-events: none;
  box-shadow: 0 12px 24px rgba(36, 151, 190, 0.2);
}

.offer-button.ghost {
  color: #9aa0aa;
  background: rgba(255, 255, 255, 0.5);
  border: 1px solid rgba(145, 151, 164, 0.2);
  box-shadow: none;
}

.offer-button-fast {
  background: linear-gradient(90deg, #26a9c2, #42c9c2);
  box-shadow: 0 12px 24px rgba(38, 169, 194, 0.18);
}

.offer-button-standard {
  background: linear-gradient(90deg, #238ec6, #36b8d8);
  box-shadow: 0 12px 24px rgba(35, 142, 198, 0.2);
}

.offer-button-premium {
  background: linear-gradient(90deg, #1d74b8, #2fa2d4);
  box-shadow: 0 12px 24px rgba(29, 116, 184, 0.22);
}

.offer-card ul {
  display: grid;
  align-content: start;
  gap: 14px;
  margin: 0;
  padding: 0;
  list-style: none;
}

.offer-card li {
  position: relative;
  padding-left: 28px;
  color: #343a45;
  font-size: 16px;
  line-height: 1.32;
}

.offer-card li::before {
  content: "";
  position: absolute;
  left: 0;
  top: 2px;
  width: 18px;
  height: 18px;
  border: 2px solid #5d6a79;
  border-radius: 999px;
}

.offer-card li::after {
  content: "";
  position: absolute;
  left: 5px;
  top: 7px;
  width: 8px;
  height: 4px;
  border-left: 2px solid #5d6a79;
  border-bottom: 2px solid #5d6a79;
  transform: rotate(-45deg);
}

.offer-card em {
  color: #7d8490;
  font-style: normal;
  font-weight: 650;
}

.theme-dark .package-offers {
  background: rgba(10, 22, 40, 0.86);
}

.theme-dark .offer-card {
  color: #eef8ff;
  background: rgba(13, 29, 54, 0.72);
  border-color: rgba(185, 211, 238, 0.12);
}

.theme-dark .offer-card.featured,
.theme-dark .offer-card.premium {
  background:
    radial-gradient(circle at 78% 10%, rgba(120, 99, 255, 0.2), transparent 34%),
    linear-gradient(180deg, rgba(27, 30, 67, 0.9), rgba(12, 25, 48, 0.74));
}

.theme-dark .offer-price strong,
.theme-dark .offer-card h3,
.theme-dark .offer-card li {
  color: #f3fbff;
}

.theme-dark .offer-card p,
.theme-dark .offer-price span,
.theme-dark .offer-card em {
  color: #b8c7d8;
}

.package-comparison {
  width: min(100%, var(--showcase-width));
  margin-inline: auto;
  overflow-x: auto;
  border: 1px solid var(--line);
  border-radius: 20px;
  background: var(--surface-strong);
  box-shadow: 0 30px 80px rgba(17, 45, 78, 0.09);
  backdrop-filter: blur(18px);
}

.package-comparison table {
  width: 100%;
  min-width: 0;
  border-collapse: separate;
  border-spacing: 0;
  color: var(--card-text);
  table-layout: fixed;
}

.package-comparison th,
.package-comparison td {
  height: 36px;
  padding: 4px 8px;
  border-right: 2px solid rgba(255, 255, 255, 0.78);
  border-bottom: 2px solid rgba(255, 255, 255, 0.78);
  background: rgba(255, 255, 255, 0.46);
  text-align: center;
  vertical-align: middle;
}

.package-comparison thead th {
  background: #68c5cf;
  color: #ffffff;
  font-size: clamp(12px, 1vw, 16px);
  font-weight: 850;
  line-height: 1.05;
}

.package-comparison thead th:first-child {
  width: 13%;
  color: #33aeb8;
  background: #d6f3f6;
  text-align: left;
  font-size: clamp(12px, 0.95vw, 15px);
}

.package-comparison thead th:nth-child(2) {
  width: 47%;
}

.package-comparison thead th:nth-child(5) {
  background: #72bfdf;
}

.package-comparison thead th:nth-child(6) {
  background: #244ea5;
}

.package-comparison thead span {
  display: block;
  margin-top: 2px;
  font-size: clamp(9px, 0.72vw, 11px);
  font-weight: 600;
}

.package-comparison tbody th,
.package-comparison tbody td {
  background: rgba(245, 247, 249, 0.78);
}

.package-comparison tr:last-child th,
.package-comparison tr:last-child td {
  border-bottom: 0;
}

.package-comparison th:last-child,
.package-comparison td:last-child {
  border-right: 0;
}

.sample-format {
  color: #39b7be;
  font-size: clamp(12px, 0.95vw, 15px);
  font-weight: 850;
  line-height: 1.16;
}

.assay-icon {
  width: 38px;
}

.assay-name {
  text-align: left !important;
  font-size: clamp(12px, 0.95vw, 15px);
  font-weight: 760;
  line-height: 1.15;
}

.assay-name span {
  color: rgba(11, 20, 38, 0.55);
  font-size: 0.72em;
  font-weight: 650;
}

.included {
  position: relative;
  display: inline-block;
  width: 22px;
  height: 22px;
  border: 2px solid #416fbe;
  border-radius: 999px;
}

.included::after {
  content: "";
  position: absolute;
  left: 6px;
  top: 4px;
  width: 5px;
  height: 10px;
  border: solid #416fbe;
  border-width: 0 2px 2px 0;
  transform: rotate(42deg);
}

.package-legend {
  display: flex;
  gap: 10px;
  align-items: center;
  padding: 8px 12px 8px;
  color: var(--card-text);
  font-size: clamp(12px, 1vw, 15px);
  font-weight: 720;
}

.package-legend .included {
  width: 20px;
  height: 20px;
  border-width: 2px;
}

.package-legend .included::after {
  left: 5px;
  top: 3px;
  width: 5px;
  height: 10px;
  border-width: 0 2px 2px 0;
}

.faq-section {
  padding-top: clamp(70px, 8vw, 116px);
}

.faq-list {
  display: grid;
  grid-template-columns: repeat(2, minmax(0, 1fr));
  gap: 16px;
}

.faq-item {
  position: relative;
  min-width: 0;
  border: 1px solid var(--line);
  border-radius: 18px;
  background: rgba(255, 255, 255, 0.62);
  box-shadow: 0 22px 58px rgba(17, 45, 78, 0.08);
  color: var(--card-text);
  overflow: hidden;
  backdrop-filter: blur(18px);
}

.theme-dark .faq-item {
  background: rgba(7, 15, 30, 0.6);
  box-shadow: 0 24px 68px rgba(0, 116, 255, 0.14);
}

.faq-item summary {
  position: relative;
  display: block;
  padding: 22px 68px 22px 24px;
  color: var(--ink);
  font-size: clamp(17px, 1.35vw, 22px);
  font-weight: 820;
  line-height: 1.24;
  cursor: pointer;
  list-style: none;
}

.faq-keyword {
  color: color-mix(in srgb, var(--blue) 72%, var(--violet) 28%);
  text-shadow: 0 0 18px rgba(38, 216, 255, 0.12);
}

.theme-dark .faq-keyword {
  color: color-mix(in srgb, var(--cyan) 72%, var(--violet) 28%);
  text-shadow: 0 0 18px rgba(38, 216, 255, 0.22);
}

.faq-item summary::-webkit-details-marker {
  display: none;
}

.faq-item summary::after {
  content: "▾";
  display: inline-grid;
  place-items: center;
  width: 28px;
  height: 28px;
  border: 1px solid var(--line);
  border-radius: 999px;
  color: var(--cyan);
  font-size: 18px;
  font-weight: 760;
  line-height: 1;
  transform: translateY(-50%);
  transition: transform 180ms ease, color 180ms ease;
}

.faq-item[open] summary::after {
  color: var(--magenta);
  transform: translateY(-50%) rotate(180deg);
}

.faq-item summary::after {
  position: absolute;
  right: 24px;
  top: 50%;
  display: grid;
}

.faq-item p {
  margin: -4px 24px 24px;
  color: var(--card-muted);
  font-size: 15px;
  line-height: 1.68;
}

.bio-footer {
  position: relative;
  z-index: 2;
  display: grid;
  grid-template-columns: minmax(220px, 0.9fr) minmax(420px, 1.55fr) minmax(300px, 1fr);
  gap: clamp(30px, 4vw, 62px);
  width: min(100%, 1320px);
  margin: 0 auto;
  padding: clamp(42px, 5vw, 70px) clamp(24px, 4vw, 54px) clamp(34px, 4vw, 54px);
  border-top: 1px solid var(--line);
  color: var(--soft);
}

.bio-footer h3,
.bio-footer h4,
.bio-footer strong {
  color: var(--ink);
}

.theme-dark .bio-footer h3,
.theme-dark .bio-footer h4,
.theme-dark .bio-footer strong {
  color: #eef8ff;
}

.bio-footer h3 {
  margin: 0 0 16px;
  font-size: 15px;
  font-weight: 860;
}

.bio-footer h4 {
  margin: 16px 0 8px;
  font-size: 13px;
  font-weight: 820;
}

.bio-footer a,
.bio-footer p {
  color: inherit;
  font-size: 12px;
  line-height: 1.55;
}

.bio-footer a {
  display: block;
}

.bio-footer-brand {
  display: grid;
  align-content: start;
  gap: 28px;
}

.bio-footer-logo {
  display: inline-flex;
  width: min(180px, 62vw);
}

.bio-footer-follow {
  display: grid;
  gap: 10px;
}

.bio-footer-follow div {
  display: flex;
  flex-wrap: wrap;
  gap: 8px 14px;
}

.bio-footer-follow a {
  font-weight: 720;
}

.bio-footer-copy {
  display: grid;
  gap: 6px;
}

.bio-footer-services,
.bio-footer-meta {
  min-width: 0;
}

.bio-footer-grid {
  display: grid;
  grid-template-columns: repeat(2, minmax(0, 1fr));
  gap: clamp(22px, 3vw, 42px);
}

.bio-footer-products {
  display: grid;
  gap: 6px;
}

.bio-footer-meta {
  display: grid;
  gap: 28px;
}

.bio-footer-meta > div {
  display: grid;
  gap: 5px;
}

.bio-footer-meta p {
  margin-top: 5px;
}

.assay-icon span {
  --icon-color: #51c0c7;
  position: relative;
  display: inline-block;
  width: 25px;
  height: 25px;
  color: var(--icon-color);
}

.icon-plate {
  border: 2px solid currentColor;
  border-radius: 4px 4px 9px 9px;
  transform: perspective(72px) rotateX(14deg);
}

.icon-plate::before,
.icon-titer::before {
  content: "";
  position: absolute;
  inset: 5px;
  background-image: radial-gradient(currentColor 1.7px, transparent 1.9px);
  background-size: 7px 7px;
  opacity: 0.72;
}

.icon-titer {
  border: 2px solid currentColor;
  border-radius: 4px;
}

.icon-titer::after {
  content: "Y";
  position: absolute;
  right: -6px;
  top: -7px;
  display: grid;
  place-items: center;
  width: 13px;
  height: 13px;
  border: 2px solid #5ba9d8;
  border-radius: 999px;
  background: rgba(255, 255, 255, 0.86);
  color: #5ba9d8;
  font-size: 7px;
  font-weight: 900;
}

.icon-purification {
  border: 2px solid currentColor;
  border-radius: 4px;
}

.icon-purification::before {
  content: "";
  position: absolute;
  inset: 5px;
  background-image: radial-gradient(currentColor 1.45px, transparent 1.7px);
  background-size: 5px 5px;
  opacity: 0.65;
}

.icon-purification::after {
  content: "1/2";
  position: absolute;
  right: -6px;
  top: -7px;
  display: grid;
  place-items: center;
  width: 13px;
  height: 13px;
  border: 2px solid #5ba9d8;
  border-radius: 999px;
  background: rgba(255, 255, 255, 0.86);
  color: #5ba9d8;
  font-size: 6px;
  font-weight: 900;
}

.icon-antibody {
  width: 38px !important;
  height: 38px !important;
  border-radius: 0;
}

.icon-antibody::before,
.icon-antibody::after {
  content: "";
  position: absolute;
  top: 15px;
  width: 21px;
  height: 8px;
  border: 2px solid currentColor;
  border-left: 0;
  border-radius: 0 9px 9px 0;
  background: transparent;
  transform-origin: 2px 50%;
}

.icon-antibody::before {
  left: 17px;
  transform: rotate(-42deg);
}

.icon-antibody::after {
  left: 17px;
  transform: rotate(42deg);
}

.icon-antibody {
  background:
    radial-gradient(circle at 50% 7px, currentColor 0 5px, transparent 5.5px),
    linear-gradient(currentColor, currentColor) 50% 11px / 7px 23px no-repeat,
    linear-gradient(currentColor, currentColor) 36% 29px / 6px 16px no-repeat,
    linear-gradient(currentColor, currentColor) 64% 29px / 6px 16px no-repeat;
}

.icon-screen {
  border: 2px solid currentColor;
  border-bottom-width: 7px;
  border-radius: 5px 5px 3px 3px;
}

.icon-screen::before {
  content: "";
  position: absolute;
  left: 7px;
  right: 7px;
  top: 7px;
  height: 16px;
  border: 2px solid currentColor;
  border-radius: 3px;
  background:
    linear-gradient(135deg, transparent 36%, currentColor 37% 45%, transparent 46% 60%, currentColor 61% 69%, transparent 70%);
  opacity: 0.76;
}

.icon-chart {
  border-left: 2px solid currentColor;
  border-bottom: 2px solid currentColor;
}

.icon-chart::before {
  content: "";
  position: absolute;
  left: 8px;
  bottom: 5px;
  width: 3px;
  height: 16px;
  background: currentColor;
  box-shadow:
    10px -7px 0 currentColor,
    20px -1px 0 currentColor,
    30px -13px 0 currentColor;
  opacity: 0.72;
}

.icon-chart::after {
  content: "Y";
  position: absolute;
  right: -6px;
  top: -7px;
  display: grid;
  place-items: center;
  width: 13px;
  height: 13px;
  border: 2px solid #5ba9d8;
  border-radius: 999px;
  background: rgba(255, 255, 255, 0.86);
  color: #5ba9d8;
  font-size: 7px;
  font-weight: 900;
}

.icon-temp {
  width: 15px !important;
  height: 31px !important;
  border: 2px solid currentColor;
  border-bottom: 0;
  border-radius: 999px 999px 0 0;
}

.icon-temp::before {
  content: "";
  position: absolute;
  right: -8px;
  top: 8px;
  width: 7px;
  height: 2px;
  background: currentColor;
  box-shadow: 0 7px 0 currentColor, 0 14px 0 currentColor;
  opacity: 0.72;
}

.icon-temp::after {
  content: "";
  position: absolute;
  left: -7px;
  bottom: -7px;
  width: 25px;
  height: 25px;
  border: 2px solid currentColor;
  border-radius: 999px;
  background: rgba(81, 192, 199, 0.22);
}

.icon-bars::before {
  content: "";
  position: absolute;
  left: 7px;
  bottom: 7px;
  width: 9px;
  height: 16px;
  background: currentColor;
  box-shadow: 13px -8px 0 currentColor, 26px -17px 0 currentColor;
  opacity: 0.85;
}

.icon-antibody,
.icon-purification,
.icon-screen,
.icon-chart,
.icon-temp,
.icon-bars {
  border: 0;
  background-repeat: no-repeat;
  background-position: center;
  background-size: contain;
  transform: none;
}

.icon-antibody::before,
.icon-antibody::after,
.icon-purification::before,
.icon-screen::before,
.icon-chart::before,
.icon-temp::before,
.icon-temp::after,
.icon-bars::before {
  content: none;
}

.icon-antibody {
  width: 31px !important;
  height: 31px !important;
  background-image: url("data:image/svg+xml,%3Csvg width='54' height='54' viewBox='0 0 54 54' xmlns='http://www.w3.org/2000/svg'%3E%3Cdefs%3E%3ClinearGradient id='g' x1='0' y1='0' x2='1' y2='1'%3E%3Cstop offset='0' stop-color='%23245fd5'/%3E%3Cstop offset='.42' stop-color='%23b6dbff'/%3E%3Cstop offset='1' stop-color='%23335dd7'/%3E%3C/linearGradient%3E%3ClinearGradient id='h' x1='0' y1='0' x2='1' y2='1'%3E%3Cstop offset='0' stop-color='%233464dd'/%3E%3Cstop offset='1' stop-color='%23233aa6'/%3E%3C/linearGradient%3E%3C/defs%3E%3Cg stroke-linecap='round' stroke-linejoin='round'%3E%3Cpath d='M27 23v23' stroke='%23d8ecff' stroke-width='15'/%3E%3Cpath d='M27 23v23' stroke='url(%23g)' stroke-width='10'/%3E%3Cpath d='M27 23L14 10' stroke='%23d8ecff' stroke-width='15'/%3E%3Cpath d='M27 23L14 10' stroke='url(%23g)' stroke-width='10'/%3E%3Cpath d='M27 23L40 10' stroke='%23d8ecff' stroke-width='15'/%3E%3Cpath d='M27 23L40 10' stroke='url(%23g)' stroke-width='10'/%3E%3Cpath d='M16 10l-7-7' stroke='url(%23h)' stroke-width='10'/%3E%3Cpath d='M38 10l7-7' stroke='url(%23h)' stroke-width='10'/%3E%3Cpath d='M27 39v8' stroke='url(%23h)' stroke-width='10'/%3E%3Cpath d='M19 26h16' stroke='%23d36a40' stroke-width='2.4'/%3E%3C/g%3E%3C/svg%3E");
}

.icon-purification {
  background-image: url("data:image/svg+xml,%3Csvg width='42' height='42' viewBox='0 0 42 42' xmlns='http://www.w3.org/2000/svg'%3E%3Crect x='3' y='7' width='32' height='30' rx='3' fill='none' stroke='%2351c0c7' stroke-width='2.6'/%3E%3Cg fill='%2351c0c7' opacity='.75'%3E%3Ccircle cx='9' cy='13' r='1.5'/%3E%3Ccircle cx='15' cy='13' r='1.5'/%3E%3Ccircle cx='21' cy='13' r='1.5'/%3E%3Ccircle cx='27' cy='13' r='1.5'/%3E%3Ccircle cx='9' cy='19' r='1.5'/%3E%3Ccircle cx='15' cy='19' r='1.5'/%3E%3Ccircle cx='21' cy='19' r='1.5'/%3E%3Ccircle cx='27' cy='19' r='1.5'/%3E%3Ccircle cx='9' cy='25' r='1.5'/%3E%3Ccircle cx='15' cy='25' r='1.5'/%3E%3Ccircle cx='21' cy='25' r='1.5'/%3E%3Ccircle cx='27' cy='25' r='1.5'/%3E%3Ccircle cx='9' cy='31' r='1.5'/%3E%3Ccircle cx='15' cy='31' r='1.5'/%3E%3Ccircle cx='21' cy='31' r='1.5'/%3E%3Ccircle cx='27' cy='31' r='1.5'/%3E%3C/g%3E%3C/svg%3E");
}

.icon-purification::after {
  content: "1/2";
}

.icon-screen {
  background-image: url("data:image/svg+xml,%3Csvg width='42' height='42' viewBox='0 0 42 42' xmlns='http://www.w3.org/2000/svg'%3E%3Cg fill='none' stroke='%2351c0c7' stroke-width='2.7' stroke-linejoin='round'%3E%3Cpath d='M8 9h26v22H8z'/%3E%3Cpath d='M6 31h30v5H6z'/%3E%3Cpath d='M13 15h16v10H13z'/%3E%3C/g%3E%3Cg stroke='%2351c0c7' stroke-width='2.4' stroke-linecap='round'%3E%3Cpath d='M16 22l3-3'/%3E%3Cpath d='M23 20l4-4'/%3E%3C/g%3E%3C/svg%3E");
}

.icon-chart {
  background-image: url("data:image/svg+xml,%3Csvg width='42' height='42' viewBox='0 0 42 42' xmlns='http://www.w3.org/2000/svg'%3E%3Cpath d='M7 7v29h30' fill='none' stroke='%2351c0c7' stroke-width='2.5' stroke-linecap='round'/%3E%3Cg fill='%2351c0c7' opacity='.78'%3E%3Crect x='13' y='22' width='4' height='12'/%3E%3Crect x='22' y='14' width='4' height='20'/%3E%3Crect x='31' y='19' width='4' height='15'/%3E%3C/g%3E%3C/svg%3E");
}

.icon-chart::after {
  content: "Y";
}

.icon-temp {
  width: 31px !important;
  height: 31px !important;
  background-size: 27px 27px;
  background-image: url("data:image/svg+xml,%3Csvg width='42' height='42' viewBox='0 0 42 42' xmlns='http://www.w3.org/2000/svg'%3E%3Cpath d='M18 7a5 5 0 0 1 10 0v18a12 12 0 1 1-10 0z' fill='none' stroke='%2351c0c7' stroke-width='2.8'/%3E%3Cpath d='M23 13v17' stroke='%2351c0c7' stroke-width='4.2' stroke-linecap='round'/%3E%3Ccircle cx='23' cy='31' r='6' fill='%2351c0c7' opacity='.42'/%3E%3Cg stroke='%2351c0c7' stroke-width='2' stroke-linecap='round' opacity='.75'%3E%3Cpath d='M30 12h5'/%3E%3Cpath d='M30 18h4'/%3E%3Cpath d='M30 24h5'/%3E%3C/g%3E%3C/svg%3E");
}

.icon-bars {
  background-image: url("data:image/svg+xml,%3Csvg width='42' height='42' viewBox='0 0 42 42' xmlns='http://www.w3.org/2000/svg'%3E%3Cg fill='%2351c0c7' opacity='.86'%3E%3Crect x='8' y='24' width='8' height='12'/%3E%3Crect x='19' y='17' width='8' height='19'/%3E%3Crect x='30' y='9' width='8' height='27'/%3E%3C/g%3E%3C/svg%3E");
}

.theme-dark .package-comparison {
  background: rgba(8, 18, 35, 0.76);
}

.theme-dark .package-comparison th,
.theme-dark .package-comparison td {
  border-color: rgba(137, 193, 236, 0.2);
}

.theme-dark .package-comparison tbody th,
.theme-dark .package-comparison tbody td {
  background: rgba(12, 27, 53, 0.74);
}

.theme-dark .package-comparison thead th:first-child {
  background: rgba(37, 99, 120, 0.9);
  color: #a6f3f6;
}

.theme-dark .assay-name span {
  color: rgba(215, 233, 248, 0.6);
}

.theme-dark .package-legend,
.theme-dark .package-comparison table {
  color: #eff8ff;
}

@media (min-width: 981px) {
  .section {
    width: min(100%, 1920px);
    margin-inline: auto;
    padding: clamp(46px, 6svh, 96px) clamp(32px, 5vw, 86px);
  }

  .hero {
    grid-template-columns: minmax(360px, 0.9fr) minmax(500px, min(48vw, 820px));
    gap: clamp(28px, 3.4vw, 64px);
    min-height: min(810px, calc(100svh - 54px));
    padding-top: clamp(34px, 5svh, 68px);
  }

  .brand-hero {
    font-size: clamp(64px, 7.4vw, 124px);
  }

  .hero-title {
    max-width: min(720px, 43vw);
    font-size: clamp(28px, 2.7vw, 46px);
  }

  .lead {
    max-width: min(640px, 45vw);
    margin-top: clamp(20px, 3svh, 30px);
    font-size: clamp(15px, 1.2vw, 20px);
  }

  .actions {
    margin-top: clamp(22px, 3.6svh, 36px);
  }

  .tilt-wrap {
    justify-self: center;
    width: min(100%, clamp(560px, 47vw, 820px));
    padding: clamp(26px, 3.2vw, 54px) clamp(14px, 1.8vw, 30px) clamp(34px, 4vw, 74px) clamp(18px, 2.4vw, 42px);
    margin: clamp(-54px, -3.2vw, -26px) clamp(-30px, -1.8vw, -14px) clamp(-74px, -4vw, -34px) clamp(-42px, -2.4vw, -18px);
  }

  .hero-surface {
    min-height: clamp(560px, 43vw, 720px);
    border-radius: clamp(18px, 1.8vw, 26px);
  }

  .layer-main {
    inset: clamp(20px, 2vw, 32px);
  }

  .surface-header {
    padding: clamp(13px, 1.1vw, 18px) clamp(14px, 1.25vw, 20px);
    font-size: clamp(10px, 0.72vw, 12px);
  }

  .factory-body {
    min-height: clamp(430px, 34vw, 560px);
    padding: clamp(14px, 1.35vw, 20px) clamp(16px, 1.8vw, 28px) clamp(16px, 1.5vw, 22px);
  }

  .factory-workflow {
    min-height: clamp(382px, 30vw, 486px);
    padding: clamp(40px, 3.5vw, 46px) clamp(8px, 0.8vw, 12px) clamp(8px, 0.8vw, 12px);
  }

  .factory-stage {
    height: clamp(320px, 25vw, 410px);
    padding: clamp(20px, 1.65vw, 24px) clamp(7px, 0.65vw, 9px) 8px;
  }

  .package-comparison {
    width: min(100%, 62vw, 1120px);
  }
}

@media (min-width: 981px) and (max-height: 860px) {
  .section {
    padding-block: clamp(36px, 5svh, 72px);
  }

  .hero {
    min-height: calc(100svh - 48px);
  }

  .brand-hero {
    font-size: clamp(58px, 7.2vw, 116px);
    margin-bottom: 12px;
  }

  .hero-title {
    font-size: clamp(28px, 2.55vw, 44px);
  }

  .lead {
    margin-top: 18px;
    line-height: 1.5;
  }

  .hero-surface {
    min-height: clamp(500px, 39vw, 650px);
  }

  .factory-body {
    min-height: clamp(390px, 31vw, 510px);
  }

  .factory-workflow {
    min-height: clamp(348px, 27vw, 430px);
  }

  .factory-stage {
    height: clamp(286px, 22vw, 350px);
  }
}

.case-study {
  grid-template-columns: 1fr 1fr;
}

.stat-row {
  display: grid;
  grid-template-columns: repeat(3, minmax(0, 1fr));
  gap: 10px;
  margin-top: 24px;
}

.stat {
  padding: 18px;
  border: 1px solid var(--line);
  border-radius: 14px;
}

.stat strong {
  display: block;
  font-size: 28px;
}

.stat span {
  display: block;
  margin-top: 6px;
  color: var(--soft);
  font-size: 12px;
}

.chart-list {
  display: grid;
  grid-template-columns: repeat(2, minmax(0, 1fr));
  gap: 10px;
  padding: 24px;
}

.chart-list span {
  min-height: 46px;
  padding: 13px 14px;
  border: 1px solid var(--line);
  border-radius: 12px;
  color: var(--muted);
  font-size: 13px;
  line-height: 1.3;
}

.case-section {
  padding-top: clamp(76px, 8vw, 120px);
}

.case-title {
  max-width: 980px;
  margin-bottom: clamp(24px, 3vw, 42px);
}

.case-title h2 {
  font-size: clamp(54px, 6vw, 92px);
  letter-spacing: 0;
}

.case-dashboard {
  display: grid;
  grid-template-columns: minmax(0, 1.14fr) minmax(360px, 0.86fr);
  gap: clamp(24px, 3vw, 42px);
  align-items: start;
}

.case-column {
  display: grid;
  gap: 16px;
  min-width: 0;
}

.case-block-title {
  margin: 0;
  color: var(--text);
  font-size: clamp(22px, 2vw, 34px);
  line-height: 1.1;
}

.case-block-title::before {
  content: ">>>";
  margin-right: 8px;
  color: #44cfd1;
  font-weight: 900;
  letter-spacing: -3px;
}

.case-panel {
  border: 1px solid rgba(76, 205, 214, 0.62);
  border-radius: 0;
  background:
    linear-gradient(180deg, rgba(255, 255, 255, 0.84), rgba(255, 255, 255, 0.66)),
    var(--grid);
  box-shadow: 0 18px 50px rgba(25, 142, 179, 0.08);
  padding: clamp(18px, 2vw, 28px);
  min-width: 0;
}

.two-charts {
  display: grid;
  grid-template-columns: repeat(2, minmax(0, 1fr));
  gap: clamp(18px, 2.4vw, 34px);
}

.mini-chart {
  min-width: 0;
}

.mini-chart h4,
.dot-chart h4 {
  margin: 0 0 14px;
  color: #57c3cb;
  font-size: clamp(19px, 1.55vw, 26px);
  line-height: 1.1;
  text-align: center;
}

.bar-plot {
  position: relative;
  display: grid;
  grid-template-columns: repeat(3, minmax(0, 1fr));
  align-items: end;
  gap: clamp(16px, 2vw, 30px);
  height: clamp(180px, 15vw, 240px);
  padding: 24px 10px 26px 18px;
  border-left: 3px solid rgba(0, 0, 0, 0.28);
  border-bottom: 3px solid rgba(0, 0, 0, 0.28);
}

.spr-bars {
  grid-template-columns: repeat(4, minmax(0, 1fr));
  height: clamp(190px, 16vw, 260px);
}

.bar-item {
  position: relative;
  display: grid;
  grid-template-rows: auto 1fr auto;
  justify-items: center;
  align-items: end;
  height: 100%;
  min-width: 0;
}

.bar-item i {
  display: block;
  width: min(64px, 72%);
  height: var(--h);
  min-height: 10px;
  background: #63c3c9;
  box-shadow: 0 8px 20px rgba(55, 188, 197, 0.2);
}

.bar-value {
  margin-bottom: 5px;
  color: var(--text);
  font-size: 12px;
  font-weight: 900;
}

.bar-item em,
.dot-chart em,
.scatter-chart em {
  display: block;
  margin-top: 8px;
  color: var(--muted);
  font-size: clamp(10px, 0.8vw, 12px);
  font-style: normal;
  font-weight: 800;
  line-height: 1.18;
  text-align: center;
}

.dot-grid {
  display: grid;
  grid-template-columns: repeat(3, minmax(0, 1fr));
  gap: clamp(18px, 2vw, 28px);
}

.dot-plot,
.scatter-plot {
  position: relative;
  height: clamp(210px, 18vw, 290px);
  overflow: hidden;
  border-left: 3px solid rgba(0, 0, 0, 0.28);
  border-bottom: 3px solid rgba(0, 0, 0, 0.28);
  background:
    linear-gradient(to right, rgba(64, 144, 192, 0.12) 1px, transparent 1px),
    linear-gradient(to bottom, rgba(64, 144, 192, 0.12) 1px, transparent 1px);
  background-size: 28px 28px;
}

.dot-plot::before {
  content: "";
  position: absolute;
  left: 0;
  right: 0;
  top: 31%;
  border-top: 2px dashed rgba(225, 96, 96, 0.35);
}

.dot-plot span,
.scatter-plot span {
  position: absolute;
  left: var(--x);
  top: var(--y);
  width: 5px;
  height: 5px;
  border-radius: 999px;
  background: #87351f;
  box-shadow: 0 0 0 1px rgba(91, 34, 18, 0.24);
  transform: translate(-50%, -50%);
}

.binding-panel {
  display: grid;
  gap: 24px;
}

.binding-panel h4 {
  text-align: left;
}

.scatter-plot {
  height: clamp(250px, 23vw, 360px);
  background:
    repeating-linear-gradient(145deg, transparent 0 48px, rgba(92, 150, 210, 0.23) 50px, transparent 54px),
    linear-gradient(to right, rgba(64, 144, 192, 0.16) 1px, transparent 1px),
    linear-gradient(to bottom, rgba(64, 144, 192, 0.16) 1px, transparent 1px);
  background-size: auto, 30px 30px, 30px 30px;
}

.scatter-plot span {
  width: 6px;
  height: 6px;
  background: #d34235;
  box-shadow: 0 0 0 1px rgba(190, 48, 38, 0.2);
}

.theme-dark .case-panel {
  background:
    linear-gradient(180deg, rgba(10, 26, 48, 0.9), rgba(10, 26, 48, 0.76)),
    var(--grid);
  box-shadow: 0 22px 70px rgba(0, 0, 0, 0.18);
}

.theme-dark .bar-plot,
.theme-dark .dot-plot,
.theme-dark .scatter-plot {
  border-color: rgba(213, 230, 255, 0.36);
}

.theme-dark .bar-value {
  color: #edf5ff;
}

.theme-dark .dot-plot span {
  background: #ff8c64;
}

.theme-dark .scatter-plot span {
  background: #ff685d;
}

.case-section {
  padding-top: clamp(34px, 3.4vw, 54px);
  padding-bottom: clamp(30px, 3vw, 48px);
}

.case-title {
  display: grid;
  grid-template-columns: minmax(220px, 0.55fr) minmax(360px, 1fr);
  gap: 24px;
  align-items: end;
  max-width: none;
  margin-bottom: clamp(14px, 1.5vw, 22px);
}

.case-title .eyebrow {
  grid-column: 1 / -1;
  margin-bottom: 0;
}

.case-title h2 {
  font-size: clamp(40px, 4vw, 58px);
  line-height: 0.95;
}

.case-title .muted {
  max-width: 680px;
  margin: 0 0 3px;
  font-size: clamp(14px, 1.05vw, 18px);
  line-height: 1.35;
}

.case-dashboard {
  gap: clamp(18px, 2vw, 30px);
}

.case-column {
  gap: 10px;
}

.case-block-title {
  font-size: clamp(22px, 1.75vw, 30px);
}

.case-panel {
  padding: clamp(12px, 1.25vw, 18px);
}

.two-charts,
.dot-grid {
  gap: clamp(12px, 1.4vw, 20px);
}

.mini-chart h4,
.dot-chart h4 {
  margin-bottom: 8px;
  font-size: clamp(17px, 1.25vw, 22px);
}

.bar-plot {
  height: clamp(132px, 9.2vw, 170px);
  gap: clamp(10px, 1.3vw, 18px);
  padding: 16px 8px 20px 14px;
  border-left-width: 2px;
  border-bottom-width: 2px;
}

.spr-bars {
  height: clamp(150px, 11vw, 190px);
}

.bar-item i {
  width: min(54px, 68%);
}

.bar-value {
  margin-bottom: 3px;
  font-size: 10px;
}

.bar-item em,
.dot-chart em,
.scatter-chart em {
  margin-top: 5px;
  font-size: 10px;
}

.dot-plot {
  height: clamp(132px, 10.2vw, 178px);
  border-left-width: 2px;
  border-bottom-width: 2px;
  background-size: 24px 24px;
}

.binding-panel {
  gap: 14px;
}

.scatter-plot {
  height: clamp(190px, 15vw, 250px);
  border-left-width: 2px;
  border-bottom-width: 2px;
  background-size: auto, 26px 26px, 26px 26px;
}

.case-section .footer {
  padding-top: 18px;
}

@media (max-width: 1100px) {
  .bio-footer {
    grid-template-columns: 1fr;
  }

  .bio-footer-grid {
    grid-template-columns: repeat(2, minmax(0, 1fr));
  }

  .bio-footer-meta {
    grid-template-columns: repeat(3, minmax(0, 1fr));
    gap: 24px;
  }

  .case-dashboard {
    grid-template-columns: 1fr;
  }

  .faq-list {
    grid-template-columns: 1fr;
  }

  .binding-panel {
    grid-template-columns: repeat(2, minmax(0, 1fr));
  }
}

@media (max-width: 760px) {
  .nav {
    flex-wrap: wrap;
    gap: 14px;
  }

  .nav-left {
    gap: 10px;
  }

  .biointron-mark {
    width: 116px;
    min-width: 104px;
  }

  .nav-actions {
    margin-left: auto;
  }

  .mode-switch {
    display: none;
  }

  .nav-product {
    font-size: 16px;
  }

  .bio-footer-grid,
  .bio-footer-meta {
    grid-template-columns: 1fr;
  }

  .case-title h2 {
    font-size: clamp(44px, 14vw, 68px);
  }

  .two-charts,
  .dot-grid,
  .binding-panel {
    grid-template-columns: 1fr;
  }

  .case-panel {
    padding: 16px;
  }

  .faq-item summary {
    padding: 18px 18px;
  }

  .faq-item p {
    margin: -2px 18px 20px;
  }

  .bar-plot,
  .spr-bars {
    height: 210px;
    gap: 12px;
  }

  .dot-plot,
  .scatter-plot {
    height: 240px;
  }
}

.video-strip {
  align-items: center;
  min-height: 260px;
  overflow: hidden;
}

.video-copy {
  padding: 32px;
}

.video-visual {
  height: 100%;
  min-height: 260px;
  background:
    radial-gradient(circle at 48% 48%, rgba(38, 216, 255, 0.18), transparent 28%),
    linear-gradient(135deg, rgba(23, 119, 210, 0.2), rgba(138, 98, 255, 0.1), rgba(236, 59, 157, 0.1));
}

.footer {
  display: flex;
  justify-content: space-between;
  gap: 24px;
  padding-top: 50px;
  color: var(--soft);
  font-size: 13px;
}

@media (max-width: 980px) {
  .hero,
  .section-head,
  .workflow,
  .value-cards,
  .data-layout,
  .grid-3,
  .packages,
  .case-study,
  .video-strip {
    grid-template-columns: 1fr;
  }

  .mode-switch {
    display: none;
  }

  .section {
    padding: 64px 24px;
  }

  .package-comparison {
    border-radius: 16px;
  }

  .package-comparison th,
  .package-comparison td {
    height: 38px;
    padding: 4px 8px;
  }

  .hero {
    min-height: auto;
    gap: 40px;
  }

  .hero-surface {
    min-height: 560px;
  }

  .factory-body {
    padding: 18px;
  }

  .factory-workflow {
    gap: 8px;
    padding-inline: 12px;
  }

  .factory-stage {
    padding-inline: 10px;
  }

  .brand-hero {
    width: auto;
    max-width: 100%;
    font-size: clamp(62px, 17vw, 110px);
  }

  .tilt-wrap {
    justify-self: stretch;
    width: 100%;
    padding: 34px 14px 52px;
    margin: -20px 0 -42px;
    perspective: 950px;
  }

  .layer-side {
    right: -10px;
    width: 42%;
  }

  .layer-chip {
    left: 22px;
    bottom: 24px;
  }
}

.factory-workflow {
  overflow: hidden;
}

.factory-stage {
  min-width: 0;
}

.factory-stage h4,
.stage-tag {
  max-width: 100%;
  overflow-wrap: normal;
  word-break: keep-all;
  hyphens: none;
}

.stage-tag {
  justify-self: center;
  align-self: center;
  text-align: center;
  white-space: normal;
}

.factory-stage h4 {
  font-size: clamp(10px, 0.82vw, 13px);
  align-self: stretch;
  text-align: center;
}

.antibody-radar,
.assay-orbit {
  width: min(74px, 92%);
}

.metric {
  padding: 3px 5px;
  font-size: 7px;
}

.metric.kd { left: 32%; top: -10px; }
.metric.kd2 { right: -5px; top: 20%; }
.metric.ka { right: -5px; bottom: 15%; }
.metric.dsf { left: -7px; bottom: 19%; }
.metric.ac { left: -9px; top: 26%; }
.metric.psr { left: 37%; bottom: -10px; }

.data-engine {
  width: min(74px, 88%);
  height: 98px;
  margin-inline: auto;
}

.data-engine strong {
  max-width: 54px;
  padding-inline: 5px;
  font-size: 6px;
}

.ai-card {
  width: min(68px, 94%);
  min-height: 92px;
  margin-inline: auto;
}

.ai-card strong {
  width: 38px;
  height: 38px;
  font-size: 16px;
}

/* Final overrides for the hero Rush Factory process panel. */
.hero-workflow-3 {
  grid-template-columns: minmax(0, 1fr) 34px minmax(0, 1.02fr) 34px minmax(0, 1.05fr);
  gap: 0;
  min-height: clamp(348px, 27vw, 430px);
  padding: clamp(40px, 3.5vw, 46px) 14px 44px;
}

.hero-workflow-3 .hero-flow-card {
  display: grid;
  grid-template-rows: auto 1fr auto;
  min-width: 0;
  height: clamp(286px, 22vw, 350px);
  padding: 14px 10px 10px;
}

.hero-workflow-3 .flow-step.mini-step {
  display: grid;
  grid-template-columns: 24px 1fr;
  gap: 7px;
  min-height: 46px;
  margin: 0;
  color: #0b43d4;
  font-size: clamp(9px, 0.68vw, 11px);
  line-height: 1.08;
}

.theme-dark .hero-workflow-3 .flow-step.mini-step {
  color: #d8ebff;
}

.hero-workflow-3 .flow-step.mini-step span {
  width: 23px;
  height: 23px;
  margin: 0;
  font-size: 12px;
}

.hero-workflow-3 .hero-flow-card p {
  align-self: end;
  max-width: 160px;
  margin: 7px auto 0;
  font-size: clamp(7px, 0.55vw, 9px);
  line-height: 1.18;
}

.hero-workflow-3 .hero-sequence-window {
  width: 100%;
  height: auto;
  min-height: clamp(130px, 11vw, 170px);
  margin: 6px 0 0;
}

.hero-workflow-3 .hero-sequence-stream {
  gap: 8px;
  padding: 46px 10px 12px;
}

.hero-workflow-3 .hero-sequence-stream .sequence-row {
  grid-template-columns: 18px minmax(0, 1fr);
  gap: 6px;
  align-items: center;
  min-height: 42px;
  padding: 8px 7px;
  overflow: hidden;
}

.hero-workflow-3 .hero-sequence-stream .sequence-row b {
  width: 18px;
  height: 18px;
}

.hero-workflow-3 .hero-sequence-stream .sequence-row span {
  display: block;
  min-width: 0;
  max-width: 100%;
  overflow: hidden;
  color: #286ef0;
  font-size: 5px;
  line-height: 1.22;
  overflow-wrap: anywhere;
  word-break: break-all;
}

.hero-workflow-3 .hero-orbit {
  width: min(172px, 94%);
}

.hero-workflow-3 .hero-center-antibody {
  width: 66px;
  height: 94px;
}

.hero-workflow-3 .orbit-label {
  min-width: 34px;
  min-height: 20px;
  padding: 3px 6px;
  font-size: 8px;
}

.hero-workflow-3 .hero-dashboard {
  width: 100%;
  margin: 2px 0 0;
  padding: 9px;
  transform: none;
}

.hero-workflow-3 .hero-dashboard .dash-header {
  margin-bottom: 6px;
  font-size: 8px;
}

.hero-workflow-3 .hero-dashboard .dash-grid {
  grid-template-columns: repeat(2, minmax(0, 1fr));
  gap: 6px;
}

.hero-workflow-3 .hero-dashboard .dash-tile {
  min-height: 48px;
  padding: 6px;
}

.hero-workflow-3 .hero-dashboard .dash-tile small {
  font-size: 6px;
}

.hero-workflow-3 .hero-dashboard .dash-tile b {
  margin-top: 2px;
  font-size: 7px;
}

.hero-workflow-3 .hero-dashboard .sparkline,
.hero-workflow-3 .hero-dashboard .mini-bars {
  height: 22px;
  margin-top: 4px;
}

.hero-workflow-3 .hero-data-screen {
  display: grid;
  grid-template-columns: 1.1fr 0.9fr;
  grid-template-rows: auto auto 1fr auto;
  gap: 6px;
  min-height: 158px;
  padding: 9px;
  overflow: hidden;
  border: 1px solid rgba(42, 231, 255, 0.34);
  background:
    radial-gradient(circle at 34% 18%, rgba(124, 80, 255, 0.34), transparent 38%),
    radial-gradient(circle at 82% 20%, rgba(0, 224, 255, 0.18), transparent 28%),
    linear-gradient(145deg, #25144e 0%, #112850 54%, #061a31 100%);
}

.hero-workflow-3 .hero-data-screen .dash-header {
  grid-column: 1 / -1;
  margin: 0;
  color: #dffaff;
}

.screen-stats {
  grid-column: 1 / -1;
  display: grid;
  grid-template-columns: repeat(3, minmax(0, 1fr));
  gap: 4px;
}

.screen-stats span,
.screen-metrics b {
  display: grid;
  gap: 1px;
  padding: 4px 5px;
  border: 1px solid rgba(42, 231, 255, 0.18);
  border-radius: 4px;
  background: rgba(7, 31, 64, 0.56);
}

.screen-stats b {
  color: #e6fbff;
  font-size: 10px;
  line-height: 1;
}

.screen-stats small {
  color: #35d7f2;
  font-size: 5px;
  font-weight: 800;
}

.screen-main-chart {
  position: relative;
  min-height: 58px;
  border: 1px solid rgba(42, 231, 255, 0.2);
  border-radius: 4px;
  background:
    linear-gradient(to right, rgba(113, 198, 255, 0.11) 1px, transparent 1px),
    linear-gradient(to bottom, rgba(113, 198, 255, 0.11) 1px, transparent 1px);
  background-size: 16px 14px;
}

.screen-main-chart::before,
.screen-main-chart::after {
  content: "";
  position: absolute;
  left: 8px;
  right: 8px;
  top: 17px;
  height: 30px;
  background:
    radial-gradient(circle at 8% 76%, #ffe36b 0 2px, transparent 3px),
    radial-gradient(circle at 35% 28%, #ffe36b 0 2px, transparent 3px),
    radial-gradient(circle at 62% 58%, #ffe36b 0 2px, transparent 3px),
    radial-gradient(circle at 88% 18%, #ffe36b 0 2px, transparent 3px),
    linear-gradient(150deg, transparent 0 18%, #ffe36b 19% 23%, transparent 24% 38%, #2ed8dd 39% 43%, transparent 44% 61%, #ffe36b 62% 67%, transparent 68%);
  filter: drop-shadow(0 0 5px rgba(255, 227, 107, 0.45));
  animation: chartRefresh 2.8s ease-in-out infinite;
}

.screen-main-chart::after {
  top: 24px;
  opacity: 0.65;
  background:
    linear-gradient(150deg, transparent 0 22%, #2ed8dd 23% 27%, transparent 28% 48%, #2ed8dd 49% 53%, transparent 54%);
}

.screen-side-bars {
  display: grid;
  gap: 5px;
  align-content: center;
  min-height: 58px;
  padding: 7px;
  border: 1px solid rgba(42, 231, 255, 0.2);
  border-radius: 4px;
  background: rgba(7, 31, 64, 0.45);
}

.screen-side-bars i {
  width: var(--w);
  height: 7px;
  border-radius: 999px;
  background: linear-gradient(90deg, #21d8ff, #ffd76c);
  animation: dataBars 4s ease-in-out infinite;
}

.screen-side-bars i:nth-child(2) { background: linear-gradient(90deg, #21d8ff, #ff777b); animation-delay: 0.1s; }
.screen-side-bars i:nth-child(3) { background: linear-gradient(90deg, #21d8ff, #80e5ff); animation-delay: 0.2s; }
.screen-side-bars i:nth-child(4) { background: linear-gradient(90deg, #21d8ff, #30efce); animation-delay: 0.3s; }

.screen-bottom {
  grid-column: 1 / -1;
  display: grid;
  grid-template-columns: 48px 1fr;
  gap: 7px;
  align-items: center;
}

.screen-donut {
  width: 42px;
  height: 42px;
  border-radius: 999px;
  background: conic-gradient(#ffbf6b 0 42%, #28d8dd 42% 74%, #ffe36b 74% 100%);
  box-shadow: inset 0 0 0 12px #241946;
}

.screen-metrics {
  display: grid;
  grid-template-columns: repeat(3, minmax(0, 1fr));
  gap: 4px;
}

.screen-metrics b {
  color: #dffaff;
  font-size: 6px;
  line-height: 1.1;
}

.hero-title,
.hero-title.typing-line {
  max-width: min(100%, 800px);
  white-space: normal;
}

.hero-title.typing-line {
  flex-wrap: wrap;
}

@media (min-width: 981px) {
  .hero {
    grid-template-columns: minmax(420px, 0.78fr) minmax(560px, min(50vw, 860px));
    gap: clamp(64px, 6vw, 118px);
  }

  .tilt-wrap {
    justify-self: end;
    margin-left: clamp(18px, 2.8vw, 54px);
    margin-right: clamp(-74px, -3.2vw, -28px);
  }

  .hero-title {
    font-size: clamp(28px, 2.55vw, 44px);
  }
}

.hero-workflow-3 .hero-assay-panel {
  overflow: visible;
}

.hero-workflow-3 .hero-sequence-panel {
  align-items: center;
}

.hero-workflow-3 .hero-sequence-panel .mini-step {
  align-self: start;
}

.hero-workflow-3 .hero-sequence-panel .hero-sequence-window {
  align-self: center;
  width: min(100%, 178px);
  min-height: clamp(150px, 12vw, 185px);
  margin: 0 auto;
}

.hero-workflow-3 .hero-sequence-panel p {
  align-self: end;
}

.hero-workflow-3 .hero-assay-panel {
  z-index: 5;
}

.hero-workflow-3 .hero-orbit {
  width: min(142px, 78%);
  margin: 0 auto;
}

.hero-workflow-3 .hero-center-antibody {
  width: 58px;
  height: 84px;
}

.hero-workflow-3 .hero-orbit .orbit-label {
  z-index: 6;
  min-width: 31px;
  min-height: 18px;
  padding: 3px 5px;
  font-size: 7px;
  white-space: nowrap;
}

.hero-workflow-3 .hero-orbit .orbit-label.kd {
  left: 50%;
  top: -7px;
  transform: translateX(-50%);
}

.hero-workflow-3 .hero-orbit .orbit-label.ka {
  left: -16px;
  top: 40%;
}

.hero-workflow-3 .hero-orbit .orbit-label.koff {
  right: -16px;
  top: 40%;
}

.hero-workflow-3 .hero-orbit .orbit-label.dsf {
  right: -2px;
  top: 16%;
}

.hero-workflow-3 .hero-orbit .orbit-label.ac {
  left: -28px;
  bottom: 18%;
}

.hero-workflow-3 .hero-orbit .orbit-label.psr {
  right: -14px;
  bottom: 18%;
}

.hero-workflow-3 .hero-data-bridge {
  z-index: 1;
}

@media (max-width: 980px) {
  .hero-workflow-3 {
    grid-template-columns: minmax(0, 1fr) 26px minmax(0, 1.02fr) 26px minmax(0, 1.05fr);
    gap: 0;
    padding: 40px 10px 42px;
  }

  .hero-workflow-3 .hero-flow-card {
    height: 286px;
    min-height: 0;
    padding: 12px 8px 9px;
  }

  .hero-workflow-3 .hero-data-bridge {
    display: block;
  }

  .hero-model-loop {
    position: absolute;
    left: 50%;
    bottom: 10px;
    width: min(250px, 58%);
    transform: translateX(-50%);
  }
}

@media (max-width: 640px) {
  .hero-workflow-3 {
    grid-template-columns: 1fr;
    gap: 12px;
    padding-bottom: 18px;
  }

  .hero-workflow-3 .hero-flow-card {
    height: auto;
    min-height: 230px;
  }

  .hero-workflow-3 .hero-data-bridge {
    display: none;
  }

  .hero-model-loop {
    position: relative;
    left: auto;
    bottom: auto;
    width: 100%;
    transform: none;
  }
}

@media (max-width: 980px) {
  .package-offers {
    grid-template-columns: 1fr;
  }

  .offer-card {
    min-height: auto;
    border-right: 0;
    border-bottom: 1px solid rgba(170, 183, 210, 0.34);
  }

  .offer-card:last-child {
    border-bottom: 0;
  }
}

/* 20260613 focused layout overrides. */
.typing-line .type-cursor {
  display: none;
}

.hero-panel-empty {
  position: relative;
  display: block;
  width: 100%;
  height: 100%;
  min-height: 0;
  padding: 0;
  overflow: hidden;
  border-radius: inherit;
}

.hero-panel-empty::before {
  content: "";
  position: absolute;
  inset: 0;
  z-index: 1;
  border-radius: inherit;
  background:
    radial-gradient(circle at 72% 28%, rgba(38, 216, 255, 0.08), transparent 36%),
    radial-gradient(circle at 30% 70%, rgba(138, 98, 255, 0.06), transparent 38%);
  opacity: 0.62;
}

.hero-science-plot {
  position: absolute;
  inset: 0;
  z-index: 0;
  display: block;
  width: 100%;
  height: 100%;
  color: rgba(198, 239, 255, 0.24);
  opacity: 1;
  filter: none;
}

.theme-white .hero-science-plot {
  color: rgba(214, 241, 255, 0.36);
}

.theme-white .hero-panel-empty {
  background:
    radial-gradient(circle at 18% 18%, rgba(38, 216, 255, 0.18), transparent 36%),
    radial-gradient(circle at 82% 78%, rgba(87, 132, 255, 0.13), transparent 42%),
    linear-gradient(145deg, #07182d 0%, #0b2442 52%, #06101e 100%);
  border-color: rgba(15, 58, 96, 0.2);
  box-shadow:
    inset 0 1px 0 rgba(255, 255, 255, 0.08),
    0 28px 72px rgba(16, 50, 86, 0.18);
}

.theme-white .hero-panel-empty::before {
  background:
    radial-gradient(circle at 72% 28%, rgba(109, 215, 255, 0.11), transparent 36%),
    radial-gradient(circle at 30% 70%, rgba(121, 145, 255, 0.08), transparent 38%),
    linear-gradient(135deg, rgba(255, 255, 255, 0.02), transparent 56%);
  opacity: 0.78;
}

.plot-grid path {
  fill: none;
  stroke: currentColor;
  stroke-width: 0.9;
  opacity: 0.3;
}

.plot-grid path:first-child {
  stroke: currentColor;
  stroke-width: 0.9;
  opacity: 0.3;
}

.plot-grid path:last-child {
  stroke-width: 1.5;
  opacity: 0.42;
}

.plot-curves path {
  fill: none;
  stroke-linecap: round;
  stroke-linejoin: round;
  stroke: currentColor;
  stroke-width: 4;
  opacity: 0.64;
}

.plot-curves path:nth-child(2n) {
  opacity: 0.52;
}

.plot-curves path:nth-child(3n) {
  opacity: 0.38;
}

.workflow-showcase.rush-flow-board {
  grid-template-columns: minmax(0, 1fr) 42px minmax(0, 1.02fr) 42px minmax(0, 1.05fr);
  min-height: clamp(470px, 35vw, 590px);
  padding: clamp(58px, 4.8vw, 78px) clamp(28px, 4vw, 70px) clamp(64px, 5vw, 82px);
}

.workflow-image-board {
  position: relative;
  display: grid;
  place-items: center;
  width: min(100%, var(--showcase-width));
  margin-inline: auto;
  overflow: hidden;
  border: 1px solid rgba(114, 165, 224, 0.22);
  border-radius: 22px;
  background: #eef7ff;
  box-shadow: 0 24px 70px rgba(31, 90, 148, 0.12);
}

.theme-dark .workflow-image-board {
  border-color: rgba(135, 205, 255, 0.2);
  background: #eef7ff;
  box-shadow:
    0 30px 86px rgba(0, 0, 0, 0.34),
    0 0 46px rgba(38, 216, 255, 0.08);
}

.workflow-image-board img {
  display: block;
  width: min(100%, 1120px);
  aspect-ratio: 1745 / 880;
  background: #eef7ff;
  object-fit: contain;
}

#workflow *,
#workflow *::before,
#workflow *::after,
#data .data-visual *,
#data .data-visual *::before,
#data .data-visual *::after {
  animation: none !important;
  transition: none !important;
}

.api-window {
  display: grid;
  grid-template-columns: minmax(0, 0.82fr) minmax(0, 1.18fr);
  gap: clamp(14px, 2vw, 24px);
  align-items: stretch;
  margin-top: 18px;
  padding: clamp(16px, 2vw, 24px);
  border: 1px solid var(--line);
  border-radius: 18px;
  background:
    linear-gradient(135deg, rgba(255, 255, 255, 0.74), rgba(236, 249, 255, 0.54)),
    rgba(255, 255, 255, 0.2);
  box-shadow: 0 24px 68px rgba(17, 45, 78, 0.08);
}

.theme-dark .api-window {
  background:
    radial-gradient(circle at 82% 18%, rgba(38, 216, 255, 0.13), transparent 34%),
    linear-gradient(135deg, rgba(13, 33, 60, 0.84), rgba(8, 18, 35, 0.68));
}

.api-copy {
  display: grid;
  align-content: center;
  gap: 8px;
}

.api-copy span {
  color: var(--cyan);
  font-size: 12px;
  font-weight: 850;
  letter-spacing: 0.08em;
  text-transform: uppercase;
}

.api-copy strong {
  max-width: 520px;
  color: var(--text);
  font-size: clamp(20px, 1.9vw, 28px);
  line-height: 1.1;
}

.api-copy p {
  max-width: 540px;
  margin: 0;
  color: var(--muted);
  font-size: 14px;
  line-height: 1.55;
}

.api-endpoint-list {
  display: grid;
  gap: 10px;
  margin-top: 12px;
}

.api-endpoint-list div {
  display: grid;
  grid-template-columns: auto minmax(0, 1fr);
  gap: 2px 10px;
  align-items: center;
  padding: 12px 14px;
  border: 1px solid rgba(38, 216, 255, 0.16);
  border-radius: 12px;
  background: rgba(255, 255, 255, 0.38);
}

.theme-dark .api-endpoint-list div {
  background: rgba(7, 20, 40, 0.54);
}

.api-endpoint-list b {
  grid-row: span 2;
  color: var(--cyan);
  font-size: 13px;
  letter-spacing: 0.08em;
}

.api-endpoint-list span {
  min-width: 0;
  color: var(--card-text);
  font-family: Consolas, "Courier New", monospace;
  font-size: 13px;
  font-weight: 760;
  overflow-wrap: anywhere;
}

.api-endpoint-list em {
  color: var(--muted);
  font-size: 12px;
  font-style: normal;
}

.api-window pre {
  margin: 0;
  min-width: 0;
  overflow: hidden;
  border: 1px solid rgba(38, 216, 255, 0.22);
  border-radius: 14px;
  background: #07182d;
  box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.06);
}

.api-window code {
  display: block;
  padding: 16px 18px;
  overflow-x: auto;
  color: #dffaff;
  font-family: Consolas, "Courier New", monospace;
  font-size: clamp(10px, 0.9vw, 13px);
  line-height: 1.55;
  white-space: pre;
}

@media (max-width: 820px) {
  .api-window {
    grid-template-columns: 1fr;
  }

  .api-window code {
    font-size: 11px;
  }
}

.workflow-showcase.hero-workflow-3 .hero-flow-card {
  height: clamp(330px, 24vw, 390px);
  padding: 18px 12px 12px;
}

.workflow-showcase.hero-workflow-3 .flow-step.mini-step {
  grid-template-columns: 28px 1fr;
  gap: 9px;
  font-size: clamp(12px, 0.9vw, 15px);
}

.workflow-showcase.hero-workflow-3 .flow-step.mini-step span {
  width: 27px;
  height: 27px;
  font-size: 13px;
}

.workflow-showcase.hero-workflow-3 .hero-flow-card p {
  max-width: 220px;
  font-size: clamp(10px, 0.72vw, 13px);
}

.workflow-showcase.hero-workflow-3 .hero-sequence-window {
  min-height: clamp(168px, 13vw, 210px);
}

.workflow-showcase.hero-workflow-3 .hero-orbit {
  width: min(220px, 94%);
}

.workflow-showcase.hero-workflow-3 .hero-center-antibody {
  width: 78px;
  height: 112px;
}

.workflow-showcase.hero-workflow-3 .hero-data-screen {
  min-height: clamp(196px, 15vw, 230px);
}

.workflow-showcase .hero-model-loop {
  bottom: 18px;
  width: min(360px, 42%);
}

@media (max-width: 1180px) {
  .workflow-showcase.rush-flow-board {
    grid-template-columns: minmax(0, 1fr) 32px minmax(0, 1.02fr) 32px minmax(0, 1.05fr);
    gap: 0;
    padding-inline: 24px;
  }

  .workflow-showcase .hero-data-bridge {
    display: block;
    width: 100%;
    height: 100%;
    margin: 0;
    transform: none;
  }
}

@media (min-width: 981px) {
  .hero-title.typing-line {
    max-width: min(720px, 43vw);
  }
}

@media (max-width: 980px) {
  .value-cards {
    grid-template-columns: repeat(2, minmax(0, 1fr));
  }

  .customer-strip {
    grid-template-columns: 1fr;
    margin-top: 22px;
  }

  .workflow-showcase.rush-flow-board {
    grid-template-columns: minmax(0, 1fr) 26px minmax(0, 1.02fr) 26px minmax(0, 1.05fr);
    padding: 42px 12px 48px;
  }
}

@media (max-width: 640px) {
  .value-cards {
    gap: 12px;
  }

  .customer-strip {
    gap: 10px 14px;
    padding: 16px 18px;
  }

  .customer-strip-label,
  .customer-strip strong {
    font-size: 14px;
  }

  .value-card {
    min-height: 220px;
    padding: 18px;
  }

  .icon-slot {
    width: 72px;
    height: 72px;
    margin-bottom: 20px;
  }

  .workflow-showcase.rush-flow-board {
    grid-template-columns: 1fr;
    gap: 12px;
    padding: 20px;
  }
}

/* Keep the primary product story layouts horizontal even on portrait screens. */
@media (max-width: 980px) {
  .hero {
    grid-template-columns: minmax(0, 0.82fr) minmax(0, 1fr);
    align-items: center;
    gap: clamp(10px, 3vw, 18px);
    min-height: auto;
  }

  .hero > div:first-child {
    position: relative;
    z-index: 5;
    min-width: 0;
    overflow: visible;
  }

  .hero .eyebrow {
    font-size: clamp(6px, 1.7vw, 10px);
  }

  .brand-hero {
    position: relative;
    z-index: 8;
    display: block;
    width: max-content;
    max-width: none;
    font-size: clamp(28px, 9vw, 58px);
    margin-bottom: 8px;
    white-space: nowrap;
    overflow: visible;
  }

  .hero-title,
  .hero-title.typing-line {
    width: 100%;
    max-width: 100%;
    height: calc(4 * 1.24em + 0.58em);
    min-height: 0;
    font-size: clamp(13px, 4.1vw, 28px);
    line-height: 1.14;
  }

  html[lang="zh-CN"] .hero-title,
  html[lang="zh-CN"] .hero-title.typing-line {
    height: calc(3 * 1.24em + 0.58em);
  }

  .lead {
    max-width: 100%;
    margin-top: 10px;
    font-size: clamp(8px, 2vw, 13px);
    line-height: 1.35;
  }

  .hero-rollup-subtitle {
    margin-top: 8px;
    font-size: clamp(11px, 2.6vw, 17px);
    line-height: 1.16;
  }

  .actions {
    gap: 6px;
    margin-top: 12px;
  }

  .button {
    min-height: 30px;
    padding: 8px 10px;
    font-size: 8px;
  }

  .tilt-wrap {
    position: relative;
    z-index: 1;
    align-self: center;
    width: 100%;
    min-width: 0;
    padding: 14px 5px 22px;
    margin: 0;
    perspective: 760px;
  }

  .hero-surface {
    min-height: clamp(210px, 58vw, 420px);
    border-radius: 16px;
  }

  .layer-main {
    inset: 10px;
  }

  .surface-header {
    min-height: 28px;
    padding: 8px 10px;
    font-size: 7px;
  }

  .factory-body {
    min-height: clamp(160px, 46vw, 340px);
    padding: 10px;
  }

  .hero-panel-empty {
    height: 100%;
    min-height: 0;
  }

  .workflow-showcase.rush-flow-board {
    grid-template-columns: minmax(0, 1fr) 20px minmax(0, 1.02fr) 20px minmax(0, 1.05fr);
    gap: 0;
    min-height: clamp(250px, 72vw, 420px);
    padding: 34px 8px 40px;
  }

  .workflow-showcase.hero-workflow-3 .hero-flow-card {
    height: clamp(190px, 54vw, 300px);
    min-height: 0;
    padding: 9px 5px 7px;
  }

  .workflow-showcase.hero-workflow-3 .flow-step.mini-step {
    grid-template-columns: 18px 1fr;
    gap: 5px;
    min-height: 34px;
    font-size: clamp(7px, 1.9vw, 10px);
  }

  .workflow-showcase.hero-workflow-3 .flow-step.mini-step span {
    width: 18px;
    height: 18px;
    font-size: 9px;
  }

  .workflow-showcase.hero-workflow-3 .hero-flow-card p {
    max-width: 96%;
    font-size: clamp(5px, 1.45vw, 8px);
  }

  .workflow-showcase.hero-workflow-3 .hero-sequence-window {
    min-height: clamp(90px, 27vw, 150px);
  }

  .workflow-showcase.hero-workflow-3 .hero-sequence-stream {
    padding: 34px 6px 8px;
  }

  .workflow-showcase.hero-workflow-3 .hero-sequence-stream .sequence-row {
    grid-template-columns: 12px minmax(0, 1fr);
    min-height: 30px;
    padding: 5px;
  }

  .workflow-showcase.hero-workflow-3 .hero-sequence-stream .sequence-row b {
    width: 12px;
    height: 12px;
  }

  .workflow-showcase.hero-workflow-3 .hero-orbit {
    width: min(132px, 94%);
  }

  .workflow-showcase.hero-workflow-3 .hero-center-antibody {
    width: 46px;
    height: 68px;
  }

  .workflow-showcase.hero-workflow-3 .orbit-label {
    min-width: 24px;
    min-height: 15px;
    padding: 2px 4px;
    font-size: 5px;
  }

  .workflow-showcase.hero-workflow-3 .hero-data-screen {
    min-height: clamp(112px, 31vw, 170px);
    padding: 6px;
  }

  .workflow-showcase .hero-model-loop {
    position: absolute;
    left: 50%;
    bottom: 8px;
    width: min(220px, 48%);
    min-height: 28px;
    transform: translateX(-50%);
    font-size: 7px;
  }

  .package-offers {
    grid-template-columns: minmax(0, 1fr) minmax(0, 1.2fr) minmax(0, 1fr);
    border-radius: 14px;
  }

  .offer-card {
    grid-template-rows: auto auto auto minmax(58px, auto) auto 1fr;
    min-width: 0;
    min-height: 360px;
    padding: clamp(12px, 2.4vw, 20px);
    border-right: 1px solid rgba(170, 183, 210, 0.34);
    border-bottom: 0;
    overflow: hidden;
  }

  .offer-card h3 {
    margin-bottom: 10px;
    font-size: clamp(15px, 3.4vw, 24px);
    overflow-wrap: anywhere;
  }

  .offer-badge {
    position: static;
    justify-self: start;
    width: fit-content;
    max-width: 100%;
    margin-bottom: 7px;
    padding: 4px 6px;
    font-size: clamp(4px, 1.15vw, 6px);
    line-height: 1;
    white-space: nowrap;
  }

  .offer-price {
    min-height: 54px;
  }

  .offer-price span {
    font-size: clamp(9px, 2.3vw, 14px);
  }

  .offer-price strong {
    font-size: clamp(11px, 3vw, 24px);
    white-space: nowrap;
    overflow-wrap: normal;
  }

  .offer-card p {
    min-height: 58px;
    font-size: clamp(7px, 1.65vw, 11px);
    overflow: hidden;
  }

  .offer-button {
    justify-self: start;
    inline-size: calc(100% - 16px);
    max-inline-size: calc(100% - 16px);
    width: calc(100% - 16px);
    min-width: 0;
    min-height: 34px;
    padding: 6px 2px;
    margin-bottom: 16px;
    font-size: clamp(5px, 1.55vw, 10px);
    line-height: 1.15;
    text-align: center;
    white-space: normal;
    word-break: break-word;
    overflow-wrap: anywhere;
    overflow: hidden;
    box-sizing: border-box;
  }

  .offer-card ul {
    gap: 8px;
  }

  .offer-card li {
    padding-left: 18px;
    font-size: clamp(7px, 1.8vw, 11px);
    overflow-wrap: anywhere;
  }

  .offer-card li::before {
    width: 12px;
    height: 12px;
    border-width: 1px;
  }

  .offer-card li::after {
    left: 3px;
    top: 6px;
    width: 6px;
    height: 3px;
    border-left-width: 1px;
    border-bottom-width: 1px;
  }

  .case-title {
    grid-template-columns: 1fr;
    gap: 8px;
    align-items: start;
  }

  .case-title h2 {
    font-size: clamp(26px, 7vw, 40px);
  }

  .case-title .muted {
    font-size: clamp(8px, 2vw, 13px);
  }

  .case-dashboard {
    grid-template-columns: minmax(0, 1.12fr) minmax(0, 0.88fr);
    gap: 10px;
  }

  .case-block-title {
    font-size: clamp(10px, 2.8vw, 18px);
  }

  .case-panel {
    padding: 8px;
  }

  .two-charts,
  .dot-grid {
    grid-template-columns: repeat(2, minmax(0, 1fr));
    gap: 8px;
  }

  .dot-grid {
    grid-template-columns: repeat(3, minmax(0, 1fr));
  }

  .mini-chart h4,
  .dot-chart h4 {
    font-size: clamp(8px, 2vw, 13px);
  }

  .bar-plot,
  .spr-bars {
    height: clamp(76px, 24vw, 120px);
    gap: 6px;
    padding: 8px 4px 12px 8px;
  }

  .dot-plot {
    height: clamp(80px, 24vw, 125px);
  }

  .scatter-plot {
    height: clamp(118px, 34vw, 180px);
  }
}

@media (max-width: 640px) {
  .workflow-showcase.rush-flow-board {
    grid-template-columns: minmax(0, 1fr) 16px minmax(0, 1.02fr) 16px minmax(0, 1.05fr);
    gap: 0;
    padding: 28px 6px 34px;
  }

  .workflow-showcase .hero-data-bridge {
    display: block;
  }
}

/* 20260615 desktop responsiveness guardrails. */
html,
body {
  width: 100%;
  max-width: 100%;
  overflow-x: clip;
}

img,
video,
iframe,
svg {
  max-width: 100%;
}

.site {
  overflow-x: clip;
  overflow-y: visible;
}

.nav,
.section,
.bio-footer {
  width: min(100%, 1920px);
  margin-inline: auto;
}

.section,
.nav,
.bio-footer,
.hero,
.section-head,
.embedded-video-card,
.package-offers,
.workflow-image-board,
.report-frame-shell {
  min-width: 0;
}

.hero > *,
.section-head > *,
.embedded-video-card > *,
.package-offers > *,
.bio-footer > *,
.bio-footer-grid > *,
.bio-footer-meta > * {
  min-width: 0;
}

.brand-hero,
.hero-title,
.lead,
.section-head h2,
.story-subtitle,
.muted,
.offer-card p,
.offer-card li,
.faq-item summary,
.bio-footer a,
.bio-footer p {
  overflow-wrap: anywhere;
}

.report-frame-shell {
  max-width: 100%;
}

.workflow-image-board {
  min-height: clamp(220px, 24vw, 460px);
}

.workflow-image-board img {
  max-height: min(58vh, 520px);
}

@media (min-width: 981px) and (max-width: 1440px) {
  .nav {
    padding-inline: clamp(28px, 4vw, 56px);
  }

  .section {
    padding-inline: clamp(28px, 4.4vw, 64px);
  }

  .hero {
    grid-template-columns: minmax(330px, 0.92fr) minmax(440px, 0.88fr);
    gap: clamp(28px, 4vw, 56px);
  }

  .tilt-wrap {
    width: min(100%, clamp(500px, 43vw, 720px));
    margin-right: clamp(-24px, -1.2vw, -10px);
  }

  .hero-surface {
    min-height: clamp(500px, 40vw, 640px);
  }

  .hero-antibody-front {
    width: min(48vw, 720px);
  }

  .embedded-video-card {
    grid-template-columns: minmax(220px, 0.38fr) minmax(0, 1fr);
  }

  .package-offers {
    width: min(100%, var(--showcase-width));
  }

  .offer-card {
    min-width: 0;
    overflow: hidden;
    padding: clamp(22px, 2.2vw, 34px);
  }

  .offer-card h3 {
    font-size: clamp(30px, 2.2vw, 36px);
  }

  .offer-badge {
    right: clamp(18px, 1.7vw, 24px);
  }

  .offer-price strong {
    display: block;
    max-width: 100%;
    font-size: clamp(24px, 2.05vw, 36px);
    line-height: 1.04;
    white-space: nowrap;
    word-break: keep-all;
    overflow-wrap: normal;
    hyphens: none;
  }

  .offer-card p {
    font-size: clamp(15px, 1.2vw, 17px);
  }

  .offer-button {
    width: 100%;
    max-width: 100%;
    box-sizing: border-box;
  }

  .offer-card li {
    font-size: clamp(14px, 1.1vw, 16px);
  }

  .bio-footer {
    grid-template-columns: minmax(190px, 0.85fr) minmax(360px, 1.4fr) minmax(260px, 0.95fr);
  }
}

@media (min-width: 981px) and (max-width: 1280px) {
  .biointron-mark {
    width: clamp(112px, 10vw, 138px);
  }

  .nav-product {
    font-size: 16px;
  }

  .hero {
    grid-template-columns: minmax(300px, 0.9fr) minmax(400px, 0.86fr);
    gap: clamp(24px, 3.2vw, 44px);
  }

  .brand-hero {
    font-size: clamp(58px, 7vw, 96px);
  }

  .hero-title,
  .hero-title.typing-line {
    max-width: min(620px, 42vw);
    font-size: clamp(24px, 2.45vw, 36px);
  }

  .lead {
    max-width: min(560px, 42vw);
    font-size: clamp(14px, 1.12vw, 17px);
  }

  .hero-antibody-front {
    right: -4vw;
    width: min(50vw, 640px);
  }

  .value-cards {
    grid-template-columns: repeat(2, minmax(0, 1fr));
  }

  .section-head {
    grid-template-columns: minmax(0, 1fr) minmax(260px, 0.62fr);
    gap: clamp(24px, 3vw, 40px);
  }

  .workflow-image-board img {
    width: min(100%, 1120px);
  }

  .report-frame-shell {
    border-radius: 18px;
  }
}

@media (min-width: 901px) and (max-width: 1100px) {
  .hero {
    grid-template-columns: minmax(0, 0.96fr) minmax(360px, 0.84fr);
    gap: 24px;
  }

  .hero-surface {
    min-height: clamp(440px, 42vw, 560px);
  }

  .factory-body {
    min-height: clamp(340px, 32vw, 460px);
  }

  .hero-antibody-front {
    right: -8vw;
    width: min(54vw, 560px);
  }

  .embedded-video-card {
    grid-template-columns: minmax(200px, 0.42fr) minmax(0, 1fr);
  }

  .embedded-video-copy {
    padding: clamp(20px, 2.4vw, 30px);
  }

  .package-offers {
    width: 100%;
  }

  .offer-card {
    padding: clamp(18px, 2vw, 26px);
  }

  .offer-price strong {
    font-size: clamp(20px, 2.35vw, 34px);
    white-space: nowrap;
    word-break: keep-all;
    overflow-wrap: normal;
    hyphens: none;
  }

  .bio-footer {
    grid-template-columns: 1fr 1.3fr;
  }

  .bio-footer-meta {
    grid-column: 1 / -1;
    grid-template-columns: repeat(3, minmax(0, 1fr));
  }
}

@media (min-width: 901px) and (max-height: 760px) {
  .nav {
    padding-block: 18px;
  }

  .section {
    padding-block: clamp(34px, 5svh, 58px);
  }

  .hero {
    min-height: auto;
    padding-top: 24px;
    padding-bottom: 34px;
  }

  .brand-hero {
    margin-bottom: 10px;
  }

  .hero-title.typing-line {
    height: calc(3.4 * 1.24em + 0.4em);
  }

  html[lang="zh-CN"] .hero-title.typing-line {
    height: calc(2.8 * 1.24em + 0.4em);
  }

  .lead {
    margin-top: 14px;
    line-height: 1.42;
  }

  .actions {
    margin-top: 18px;
  }

  .tilt-wrap {
    padding-top: 18px;
    padding-bottom: 38px;
    margin-bottom: -36px;
  }

  .hero-surface {
    min-height: clamp(390px, 34vw, 520px);
  }

  .factory-body {
    min-height: clamp(300px, 28vw, 420px);
  }

  .hero-antibody-front {
    width: min(44vw, 560px);
  }
}

@media (max-width: 980px) {
  .nav,
  .section,
  .bio-footer {
    width: 100%;
  }

  .section-head {
    grid-template-columns: 1fr;
    gap: 16px;
  }

  .embedded-video-slit {
    width: 100%;
    margin-inline: 0;
  }

  .embedded-video-card {
    display: block;
  }

  .embedded-video-window {
    min-height: clamp(220px, 42vw, 360px);
  }

  .hero-antibody-front {
    display: none;
  }

  .report-frame-shell {
    border-radius: 16px;
  }

  .workflow-image-board img {
    width: min(100%, 1120px);
  }
}

@media (max-width: 900px) {
  .package-offers {
    grid-template-columns: 1fr;
  }

  .offer-card {
    min-height: auto;
    border-right: 0;
    border-bottom: 1px solid rgba(170, 183, 210, 0.34);
  }

  .offer-card:last-child {
    border-bottom: 0;
  }

  .offer-button {
    width: fit-content;
    min-width: min(180px, 100%);
  }

  .bio-footer-meta {
    grid-template-columns: 1fr;
  }
}